The role of downstream of kinase (DOK) 3 in toll like receptor signalling

... III- 3. 8 Dok3 interacts with TRAF3 and TBK1 and is required for TBK1 binding to TRAF3 in TLR3 signalling III-80 3. 9 Dok3 binds TRAF3 and TBK1 via SH2 target motif III- 83 3.10 Dok3 does ... Dok3 binding, ABIN1 (A20-binding inhibitor of NFB) in RAW 264.7 cells upon stimulation with LPS The interaction of Dok3 and ABIN1 was then confirmed by immunoprecipitating Dok3 and immuno...

Ngày tải lên: 09/09/2015, 10:16

... during ontogeny J Exp Med 180:507 17 Hardy, R R., Carmack, C E., Shinton, S A., Kemp, J D and Hayakawa, K 1991 Resolution and characterization of pro-B and 22 23 24 25 26 27 28 29 30 31 32 33 34 ... Identification of the SH2 domain binding protein of Bruton’s tyrosine kinase as BLNK—functional significance of BtkSH2 domain in B-cell antigen receptor-coupled calcium sig...

Ngày tải lên: 16/09/2015, 17:12

... PROTEINS 37 1. 6 .1 Domains and motifs found in adaptor proteins .37 1. 6.2 Adaptor proteins in BCR signaling 38 1. 6.2 .1 1.6.2 .1. 1 1. 6.2 .1. 2 1. 6.2 .1 .3 1. 6.2.2 1. 6.2.2 .1 1.6.2.2.2 Adaptors involved ... CHARACTERIZATION OF A DOK- 3INTERACTING PROTEIN, DIP 13 0 5 .1 INTRODUCTION 13 1 5.2 CLONING OF FULL LENGTH DOK- 3 CDNA AND IDENTIFICATION OF A D...

Ngày tải lên: 16/09/2015, 17:12

... region of < /b> SHIP-1 binds to Dok-< /b> 3 < /b> at domain B and D; the < /b> SH2 domain of < /b> Grb2 binds to 39< /b> Dok-< /b> 3 < /b> at domain D; while the < /b> region responsible for binding of < /b> Abl to Dok-< /b> 3 < /b> at B is still unknown 1.4.5 .3 < /b> Dok-< /b> 4, ... SC -37< /b> 1 SC- 728 SC- 738< /b> 3 39< /b> 41 Goat Goat Rabbit Rabbit Rabbit Rabbit R...

Ngày tải lên: 14/09/2015, 09:08

... An inhibitory adaptor regulating B cell receptor signaling 3.< /b> 1 Introduction 75 3.< /b> 2 Generation of < /b> Dok-< /b> 3 < /b> deficient mice 76 3.< /b> 3 Studying the < /b> role < /b> of < /b> Dok-< /b> 3 < /b> in < /b> B cell development 81 3.< /b> 3.1 Dok-< /b> 3 < /b> is ... FcγRIIB signaling 3.< /b> 7.2 Role < /b> of < /b> Dok-< /b> 3 < /b> in <...

Ngày tải lên: 14/09/2015, 10:44

... value of 24.2 1.87 kJặmol)1 Effect of calcium on pfLamA mutants in 7.9 GdmCl and in native conditions M The addition of 40 mm CaCl2 to calcium-depleted samples of D287A and E53A in 7.9 m GdmCl ... and the uorescence properties (data not shown), Role of Glu53 and Asp287 in the stability in 7.9 M GdmCl Fig Interaction of calcium with pfLamA...

Ngày tải lên: 30/03/2014, 04:20

... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and...

Ngày tải lên: 21/02/2014, 01:20

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

... observed in weaker binders Evaluation of the VH ⁄ VL interaction strength To evaluate the VH ⁄ VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH ⁄ VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction stren...

Ngày tải lên: 07/03/2014, 12:20

... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Fr...

Ngày tải lên: 08/03/2014, 05:20

... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the...

Ngày tải lên: 14/03/2014, 14:20

... Sherraden, and Julia Stevens for comments CENTER FOR SOCIAL DEVELOPMENT WASHINGTON UNIVERSITY IN ST LOUIS i REDUCING WILT The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College ... Destin, 2009) Charles, Roscigno, and Torres (2007) is the only study of the seven to examine the relationship between parent school savings...

Ngày tải lên: 15/03/2014, 10:20

... glucokinase and hexokinase I in distinct pools [3,24], or by the involvement of mechanisms, additional to Glc6P, in mediating the effects of glucokinase overexpression As glucokinase binds to a dual-specificity ... [5,7] Conditions that cause dissociation of glucokinase from GKRP are associated with a parallel increase in the cell content of Glc6P, confirming...

Ngày tải lên: 16/03/2014, 14:20

... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... and E Hovy 2004 Determining the sentiment of opinions In Proc of COLING, pages 1367–1373 M Koppel and J Schler 2005 Using neutral examples for learning polarity In...

Ngày tải lên: 17/03/2014, 04:20

... clear upregulation of an alkane-inducible cytochrome P450 (AJ273607) The role of P450 in microbial fatty acid metabolism during the first hours of incubation [22] According to amino acid similarity, ... compounds is inherently coupled to fatty acid degradation because the conversion of alkanes to fatty acids is The role of P450 in microbial...

Ngày tải lên: 22/03/2014, 16:21