PERIPHERAL BLOOD a SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES

... Pericytes are a population of mesenchymal stem cells Bone marrow is a source of MSCs The minimal criteria of MSCs as defined by the scientific community for cellular therapy is the ability of the cell ... cytokines, are microbicidal and tumouricidal and therefore support the resistance against infections M2 are alternatively activated macrophages and the definiti...

Ngày tải lên: 09/09/2015, 10:13

... Consequently, the development of an information base on genetic, cellular, and molecular levels is now a prerequisite for the use of plants or plant cell cultures for biotechnological applications for the ... functional status of cells is now routinely performed for plant cell cultures in order to permit accurate assessment of growth and metabolite production...

Ngày tải lên: 25/10/2013, 05:20

... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase...

Ngày tải lên: 14/02/2014, 22:20

... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identification and pharmacological characterization of the various receptor subtypes, and the determination of their prec...

Ngày tải lên: 19/02/2014, 12:20

... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Serdang, Malaysia vi UNEP/SCS – National Report Malaysia NATIONAL REPORT OF MALAYSIA ON THE BAY OF BENGAL LARGE MARINE ECOSYSTEM PR...

Ngày tải lên: 06/03/2014, 15:21

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as show...

Ngày tải lên: 08/03/2014, 05:20

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

... this article as: Sakkalis et al., A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis Journal of NeuroEngineering and Rehabilitation 2010, ... bivariate measures that can be treated similarly to the ones in the univariate case Once the additional synchronization features are calculated they are fe...

Ngày tải lên: 19/06/2014, 08:20

... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design...

Ngày tải lên: 20/06/2014, 04:20

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approve...

Ngày tải lên: 20/06/2014, 04:20

... MI: The reliability of linear analogue scales for evaluating pain Anaesthesia 1976, 31(9):1191-1198 10 Wewers ME, Lowe NK: A critical review of visual analogue scales in the measurement of clinical ... describes the psychometric evaluation of a patientreported VAS for the daily assessment of anxiety when used in a clinical trial assessing pharmaceutical tre...

Ngày tải lên: 20/06/2014, 16:20

... that is, guaranteeing that the generated Rayleigh envelopes are exactly corresponding to the desired covariance matrix The model of a Rayleigh fading generator for generating an individual baseband ... FLAT RAYLEIGH FADING ENVELOPES 4.1 Covariance matrix of complex Gaussian random variables with Rayleigh fading envelopes It is known that Rayleigh fading...

Ngày tải lên: 23/06/2014, 00:20

... to study partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of...

Ngày tải lên: 23/06/2014, 00:20

... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of...

Ngày tải lên: 09/08/2014, 01:21

... 12 mice housed individually in standard breeding cages Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave ... parameters of locomotor activity Conclusion The aim of this study was to develop an apparatus consisting of a battery of radar sensors to allow th...

Ngày tải lên: 10/08/2014, 09:20