PERIPHERAL BLOOD a SIMPLE CELL SOURCE FOR THE GENERATION OF ANGIOGENIC PROGENITORS FROM MONOCYTES

... Pericytes are a population of mesenchymal stem cells Bone marrow is a source of MSCs The minimal criteria of MSCs as defined by the scientific community for cellular therapy is the ability of the cell ... cytokines, are microbicidal and tumouricidal and therefore support the resistance against infections M2 are alternatively activated macrophages and the definition of M2 was expanded to all macrophages, ... using an Apotome (Zeiss) and confocal laser-scanning microscope (Olympus) Statistical analysis Obtained values were averaged and are displayed as average value +/- standard deviation Pvalues...

The Use of Plant Cell Biotechnology for the Production of Phytochemicals

... Consequently, the development of an information base on genetic, cellular, and molecular levels is now a prerequisite for the use of plants or plant cell cultures for biotechnological applications for the ... functional status of cells is now routinely performed for plant cell cultures in order to permit accurate assessment of growth and metabolite production rates The availability of plant cells for quantitative ... elucidation of speciﬁc biosynthetic enzymes, and the identiﬁcation of end-products The complete genetic makeup of an organism has been generated in the plant sciences as well Because of the success of...

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... identiﬁcation and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase isoforms: vInv, nInv and eInv (D) Vmax of ... (1999) Acclimation of Arabid¨ opsis leaves developing at low temperatures Increasing cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle and in the sucrose-biosynthesis...

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identiﬁcation and pharmacological characterization of the various receptor subtypes, and the determination of their precise subunit composition and physiological function( s) ... targets the a/d interface of the mammalian muscle nAChR and is the only ligand selective for the Torpedo a/d interface [33] (Fig 2A) However, information on the activity of EI at neuronal subtypes...

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Serdang, Malaysia vi UNEP/SCS – National Report Malaysia NATIONAL REPORT OF MALAYSIA ON THE BAY OF BENGAL LARGE MARINE ECOSYSTEM PROGRAMME By Ishak Haji Omar* INTRODUCTION 1.1 AIM OF REPORT The aim ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as shown in Figure The details of the ... possible brackets of "stock was down 9.1 points yesterday morning" Figure 3: the transformed form of the path with dash line for the second pass processing As required in our statistical model, we have...

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on ﬁlamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...

báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf

... this article as: Sakkalis et al., A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis Journal of NeuroEngineering and Rehabilitation 2010, ... bivariate measures that can be treated similarly to the ones in the univariate case Once the additional synchronization features are calculated they are fed to the classifier to discriminate ... achieved) and the Beta band over the frontal lobe For the Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier,...

báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx

... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design of the study and performed ... Statistical analysis of ROM Statistical analysis of ROM of intact disc specimen, after nucleotomy and after implantation of the PGA-HA nucleus-implant using the Mann-Whitney Rank Sum Test The ends of the...

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... Biomaterials 1995, 16:545-551 doi: 10.1186/1749-799X-5-32 Cite this article as: Jähn et al., A rapid method for the generation of uniform acellular bone explants: a technical note Journal of Orthopaedic...

báo cáo hóa học:" Psychometric evaluation of a visual analog scale for the assessment of anxiety" pdf

... MI: The reliability of linear analogue scales for evaluating pain Anaesthesia 1976, 31(9):1191-1198 10 Wewers ME, Lowe NK: A critical review of visual analogue scales in the measurement of clinical ... describes the psychometric evaluation of a patientreported VAS for the daily assessment of anxiety when used in a clinical trial assessing pharmaceutical treatments for GAD Methods Preliminary Qualitative ... 10.1186/1477-7525-8-57 Cite this article as: Williams et al., Psychometric evaluation of a visual analog scale for the assessment of anxiety Health and Quality of Life Outcomes 2010, 8:57 Page of ...

Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

... that is, guaranteeing that the generated Rayleigh envelopes are exactly corresponding to the desired covariance matrix The model of a Rayleigh fading generator for generating an individual baseband ... FLAT RAYLEIGH FADING ENVELOPES 4.1 Covariance matrix of complex Gaussian random variables with Rayleigh fading envelopes It is known that Rayleigh fading envelopes can be generated from zero-mean, ... that, we have to calculate the variance of the outputs of Doppler ﬁlters, which may have an arbitrary value depending on the variance of the complex Gaussian random variables at the inputs of...

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... to study partial diﬀerence equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear diﬀerence equation under consideration In the case of nonlinear equations, we some manipulation ... generating analytic functions, Laurent or z-transforms, numerical schemes, boundary value problems of partial diﬀerential equations, problems of quantum mechanics, and problems of population dynamics...

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of the copy of the Necker cube test and to preliminarily test ... valuable information might be lost The reversal of the perception of the Necker cube has been extensively studied, but this is not the case concerning its copying To date no standardized method has been...

Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

... 12 mice housed individually in standard breeding cages Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave ... parameters of locomotor activity Conclusion The aim of this study was to develop an apparatus consisting of a battery of radar sensors to allow the investigation of mouse activity rhythms In addition, ... recording of the observations Radar- based monitoring systems have proved effective in the study of behaviour, both in very small animals like insects [11] and in small mammals [12] Radar systems have...

Xem thêm

Từ khóa: a unified statistical model for the identification of english basenp a shell system for the generation of clinical documents transformation and somatic cell genetics for the improvement of energy production in microalgae a fluorescence polarization assay for the discovery of inhibitors of the polo box domain of polo like kinase 1 retrospective regional risk assessment predictions and the application of a monte carlo analysis for the decline of the cherry point herring stock the majority of past biomass gasifier demonstrations have been for the generation of process heat steam and electricity r discussion it is clear that further development work is necessary to establish operating limits for most biomass gasification technologies the majority of past biomass gasifier demonstrations have been for the generation of process industrial strategies for the discovery of bioactive compounds from plants general strategy for the formation of n heterocycles from primary amines the regulations for the establishment of investment funds from abroad metallic mineral resources in finland and fennoscandia a major european raw materials source for the future fast undertaken for the cure of a profound blood disease a shell system for the generation a framework for the evaluation of text a defeasible logic reasoner for the semantic web Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP