Engineered poly(l lactic acid) based nanofibers for osteogenic differentiation of human mesenchymal stem cells
... ENGINEERED POLY(L- LACTIC ACID)- BASED NANOFIBERS FOR OSTEOGENIC DIFFERENTIATION OF HUMAN MESENCHYMAL STEM CELLS NGUYEN THI HIEN LUONG (B.Eng., Ho Chi Minh city University of Technology, ... Seeram Ramakrishna Electrospun Poly(L- lactic acid) Nanofibres Loaded with Dexamethasone to Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells...
Ngày tải lên: 09/09/2015, 10:07
... 19 The relative increase in expression of the osteogenic markers in the young donor, as a result of chordin knockdown, was within the range of that of the donors over 70 years old MSCs from young ... analysis of flow cytometry data shows the transfection efficiency of siRNA The darker peak represents the fluorescence-positive cell population, which is clearly sh...
Ngày tải lên: 09/08/2014, 10:23
... indentifying the association of HR-HPV types with these oral lesions The purpose of this study was to compare the efficacy of HC -II assay and PCR for the detection of specific HPV type (HPV 16 E6) in ... sensitivity has been developed known as hybrid capture II test (HC -II) and approved by the US food and drug administration (FDA) The perform...
Ngày tải lên: 12/08/2014, 01:22
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...
Ngày tải lên: 11/08/2014, 12:21
OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells
... 35 04 - 36 02 139 - 22 6 20 7 - 31 3 45 0 - 559 11 13 - 130 8 1 637 - 1 8 32 1559 - 1665 39 9 - 5 92 3. 60 3. 62 3. 99 4 . 34 4. 78 3. 68 3. 26 3. 4 3. 4 32 .8 29 .25 30 .7 30 .8 35 .8 27 .2 29.1 28 .3 30.8 Bold designates ... Sox- 2 297 – 37 8 5 73 – 677 1056 - 11 53 71 - 23 0 11 82 - 1 34 5 4. 55 2. 98 3. 68 3. 49 4 .36 19 .4 33 .9 28 .2...
Ngày tải lên: 27/11/2015, 11:25
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis Jeffrey R Curtis1,#, John W Baddley1,2, Shuo Yang1, ... VARA visits; all other data used for the analysis were from the administrative claims data To test the performance of the effectiveness algorithm...
Ngày tải lên: 25/10/2012, 10:45
sensor based learning for practical planning of fine motion in robotics ppt
... Perception -based learning for motion in contact in task planning, Journal of Intelligent and Robotic Systems 17 (1996) 283–308 [21] T Kohonen, in: Self-Organizing Maps, Springer Series in Information ... steps required to perform a correct insertion and is expressed in terms of cost or negative reinforcement Sutton [22] defined reinforcement learning (RL) as the learni...
Ngày tải lên: 28/03/2014, 14:20
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
... performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of the annulus defect by sewing a PGA-HA annulus-implant ... biomechanical test set-up and advised in analyzing the data 14 ME advised about the use of biomaterials and customized the PGA-HA biomaterial 15 CK participated in the design...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Functionalized halloysite nanotube-based carrier for intracellular delivery of antisense oligonucleotides" pdf
... doi:10.1186/1556-276X-6-608 Cite this article as: Shi et al.: Functionalized halloysite nanotube-based carrier for intracellular delivery of antisense oligonucleotides Nanoscale Research Letters 2011 6:608 ... http://www.nanoscalereslett.com/content/6/1/608 showed the cellular delivery efficiency of f-HNTASODNs estimated to be 98.69%, indicating that the fHNTs had high...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
sensor based learning for practical planning of fine motion in robotics doc
... Perception -based learning for motion in contact in task planning, Journal of Intelligent and Robotic Systems 17 (1996) 283–308 [21] T Kohonen, in: Self-Organizing Maps, Springer Series in Information ... steps required to perform a correct insertion and is expressed in terms of cost or negative reinforcement Sutton [22] defined reinforcement learning (RL) as the learni...
Ngày tải lên: 27/06/2014, 18:20
Báo cáo y học: "Intra-articular hyaluronan (hyaluronic acid) and hylans for the treatment of osteoarthritis: mechanisms of action" pps
... Definition and characteristics of hyaluronan (hyaluronic acid) and hylans Definition Characteristics Hyaluronan (hyaluronic acid) or sodium hyaluronate Long, nonsulfated, straight chains of variable ... [92] HA, hyaluronan (hyaluronic acid); MW, molecular weight; OA, osteoarthritis; PMN, polymorphonuclear N/A Yes Yes Yes Yes Yes N/A N/A Yes Yes Yes N/A N/A Inh...
Ngày tải lên: 09/08/2014, 01:21
báo cáo khoa học: " Social networks, work and network-based resources for the management of long-term conditions: a framework and study protocol for developing self-care support" potx
... and health status, use of self-care and self-care support, and a set of validated measures on aspects of social capital and social support A second survey instrument was administered and audio-recorded ... Trusts and the University of Manchester and is part of the National Institute for Health Research The authors are members of the Patient Them...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "A consensus-based template for uniform reporting of data from pre-hospital advanced airway management" ppt
... the uniform reporting of data following a major trauma was published to simplify the comparison of data from different trauma registries [17] We believe that a similar template for the uniform reporting ... any airway management beyond manual opening of the airway and the use of simple adjuncts, such as a Guedel airway, should be considered as advanced airway...
Ngày tải lên: 13/08/2014, 23:21
Báo cáo y học: "Using the intervention mapping protocol to develop a community-based intervention for the prevention of childhood obesity in a multi-centre European project: the IDEFICS intervention" pptx
... contrast to the sequence of intervention mapping steps, the evaluation design was already defined by the start of the European project The process evaluation was developed by the main coordinating ... during the second face -to- face meeting in November 2007 and finilised by the beginning of 2008 (Table 1) In January 2008, a central training was organised...
Ngày tải lên: 14/08/2014, 08:20