A content caching strategy for named data networking
A content caching strategy for named data networking
... Hosseini Farahabadi, Mr Sasan Safaie, Mr Hooman Shams Borhan, Mr Amir Mortazavi, Dr Abbas Eslami Kiasari They always supported me in any circumstances I would also like to thank all my flat mates during ... these five years Dr Mojtaba Ranjbar, Dr Mohammadreza Keshtkaran, Mr Hassan Amini, Mr Mehdi Ranjbar, Dr Hossein Eslami, Mr Sai Sathyanarayan, for making our home warm and joyful and for y...
Ngày tải lên: 09/09/2015, 08:17
Lore: A Database Management System for Semistructured Data ppt
... no path expressions that not exist in the database In typical situations, the DataGuide is signi cantly smaller than the original database Figure shows a DataGuide for the sample OEM database ... unique path expressions As an example, Figure 10 is a screen snapshot of the Java presentation of a DataGuide This DataGuide summarizes an existing database for Stanford's Database...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... Virology Journal 2008, 5:135 http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200...
Ngày tải lên: 20/06/2014, 01:20
a universal execution engine for distributed data-flow computing doc
... [2]—remains a popular platform for parallel iterative computations with large inputs For example, the Apache Mahout machine learning library uses Hadoop as its execution engine [3] Several of the Mahout ... languages have not demonstrated as great scalability as MapReduce or Dryad, which sacrifice expressivity for efficiency 7.3 Declarative programming The relational algebra, which...
Ngày tải lên: 27/06/2014, 23:20
Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam
... Solid Waste and Wastewater Treatment Products to Customers in Vietnam Markets The research aims to serve any sustainable medical waste treatment equipment manufacturers in the West who are interested ... Lahti University of Applied Sciences Master Programme in International Business Management BUI, THIEN TOAN Market Analysis and Developing a Competit...
Ngày tải lên: 23/07/2014, 03:36
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt
... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by th...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo sinh học: "Combined analysis of data from two granddaughter designs: A simple strategy for QTL confirmation and increasing experimental power in dairy cattle" potx
... benefits of a combined analysis of data from different granddaughter designs QTL mapping / granddaughter design / combined analysis / QTL confirmation / dairy cattle INTRODUCTION With the aid of genetic ... traits and somatic cell score in order to conduct a QTL confirmation study and to increase the experimental power Data were exchanged in a co...
Ngày tải lên: 14/08/2014, 13:22
Báo cáo y học: "A strategy for extracting and analyzing large-scale quantitative epistatic interaction data" pptx
... highly likely to be a real synthetic interaction and sc approaches as an interaction is highly likely to be a real alleviating interaction - genes with correlated patterns and a synthetic interaction ... mutations both yield slow growth phenotypes (blue circles), both yield growth phenotypes typical of our set of mutant strains (green triangles), and both yield relatively fast g...
Ngày tải lên: 14/08/2014, 16:21
Marketing Strategy for a Business Service Firm
... fundamental knowledge about strategy, marketing service strategy and the concept of effective marketing strategy This chapter aims to change the attitude of Vietnamese managers in the VFCFIs toward marketing, ... emphasis to a major function of management of organization Strategy and strategic management concepts help managers in the VFCFIs understand the important role of st...
Ngày tải lên: 23/04/2013, 10:29
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of...
Ngày tải lên: 05/09/2013, 10:15
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq
... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A...
Ngày tải lên: 29/01/2014, 00:23
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... for interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in...
Ngày tải lên: 16/02/2014, 08:20
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
... The Pathways Commission Charting a National Strategy for the Next Generation of Accountants A thank you is just not sufficient reward for the effort the Pathways representatives have put forth ... full text of Chapters & are available at www.pathwayscommission.org The Pathways Commission on Accounting Higher Education: Charting a National Stra...
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell li...
Ngày tải lên: 19/02/2014, 06:20