... time or accuracy constraints Activity recovery describes goal accomplishment by the pre-morbid dominant end effector with reasonable speed and accuracy, without body function compensation constraints ... weighted combinations of both For example, feedback designed for online control can also be used to correct motor performance in a feedforward manner [17] Thus feedback components should be constructed ... Approach to action for discriminating behavioral recovery and compensation, adapted from [24] Three types of action leading to goal accomplishment include activity compensation, activity recovery,...
Ngày tải lên: 19/06/2014, 08:20
... economic clerk transfer time cards, contracts, record of checking and taking over the buildings , units’ wages check to the company The company’s payroll accounting clerk checks and recalculates ... computer accounts: Dr.627: 22.608.900 Cr 334.1: 22.608.900 2.2 Accounts in use Account 338: Other payable Account 111: Cash on hand Account 112: Cash in bank Account 138: Other receivable Account ... diagram, we can see there are six functional accountants in accounting department: 01 chief accountant, 01 deputy department accountant, 04 functional accounting clerks and 01 cashier These clerks...
Ngày tải lên: 08/04/2013, 10:20
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC ... http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT /C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original ... 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 gene primers for Q-PCR (148 bp amplicon) Act 1+ Act 148- CCCRGAGGTHCTCTTCCARC TMCGRTCAGCAATACCAGGG 200 nM 200 nM...
Ngày tải lên: 20/06/2014, 01:20
Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam
... healthcare, hospital, medical solid waste, medical wastewater, incinerator, CITENCO, DNURENCO, AIC, competitive, marketing strategy CONTENTS 1 1.1 Research background 1.2 Research objectives, ... economic factors, social – cultural factors, technological factors and natural environment These groups of factors contain forces that can have a heavy impact on players‘ strategic decisions in ... with local competitors Legal influences – Regulations of specific technical standards heavily affect buyers‘ decisions, in particular in purchasing technical equipment Vendors can obtain a competitive...
Ngày tải lên: 23/07/2014, 03:36
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt
... deposited on the activating cell surface and are the specific ligands for CR2 molecules So CR2 is a good choice as a tarteting vector for delivery of complement inhibitors such as Crry and CD59 to sites ... thus increase inflammatory reaction CR2 is the central molecule for the immune response regulation by complement system Split products of C3 molecules includes C3 dg, iC3b, C3 d and C3 b, which are ... induce severe inflammatory reaction or tissue injury, resulting in pathological process [16] For example, complement activation can produce inflammatory media including C2 a, C3 a, C4 a and C5 a C2 a...
Ngày tải lên: 12/08/2014, 04:21
A content caching strategy for named data networking
... in-network caching, specifically for NDN, by introducing CCndnS [69] cache policy and developing a partitioning scheme for it Contributions are listed below: • CCndnS is a cache policy to increase ... increase the efficiency of network of caches by eliminating or reducing content redundancy between caches One reason en-route caching strategy leaves the core caches cold lies in the lack of cache ... in-network caching However, efficiency of in-network caching has been questioned by experts Therefore, in this thesis we propose a cache policy, CCndnS, which can increase the efficiency of innetwork caching...
Ngày tải lên: 09/09/2015, 08:17
Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies
... or biopsies Microdissected tissue Primary cell cultures Established immortal cell lines Fluorescence Activated Cell Sorted (FACS) cells Magnetic Activated Cell Sorting (MACS) is a commonly used ... Recombination' recombinase EGFP enhanced green fluorescence protein ES cells Embryonic stem cells F2A Foot and mouth virus 2A peptide FACS Fluorescence Activated Cell Sorting FITC Fluorescein Isothiocyanate ... ES cells and technical advice; Valarie Tan, for performing the mice embryo microinjections; Sumantra Chatterjee and Adrian Lim, for performing the zebrafish embryo microinjections; Yang Sun, for...
Ngày tải lên: 11/09/2015, 09:59
Báo cáo hóa học: " Research Article A Two-Microphone Noise Reduction System for Cochlear Implant Users with Nearby Microphones—Part I: Signal Processing Algorithm Design and Development" pot
... of −33 microseconds, microsecond, and +33 microseconds and exponential filters with a time constant of 6.6 milliseconds The value of the cross-correlation for the smallest lag is then compared ... 6.1 × 2.1 cm; Figure 10) which also holds the batteries, an LCD display and control buttons The output can directly drive the audio input of commercially available speech processors of cochlear ... detection algorithm was evaluated in two different simulated acoustic environments The acoustic room simulation procedure used [25] calculates simulated impulse responses between acoustic sources...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo y học: "Anatomic and functional leg-length inequality: A review and recommendation for clinical decision-making. Part I, anatomic leg-length inequality: prevalence, magnitude, effects and clinical significance" pdf
... stated: "Therefore, although conflicts in the literature exist, cm of LLD [leg length discrepancy] can be characterized as a minimum LLD, which should be treated in the clinical practice" [60] This ... length discrepancy Gait Posture 2002, 15:195-206 Cooperstein R, Lisi A: Pelvic torsion: anatomic considerations, construct validity, and chiropractic examination procedures Top Clin Chiro 2000, ... estimation of clinical significance dovetails nicely with the findings on the effects of LLI, particularly pelvic torsion [23] Passive structural changes – pelvic torsion, mild lumbar scoliosis, facet...
Ngày tải lên: 13/08/2014, 13:22
Marketing Strategy for a Business Service Firm
... International Corporation, Construction Technical Company, Asia Pacific Engineering Construction, etc INVESTIP is planning to focus its activities on Project Management consultancy, especially in construction ... the construction field need consulting services in bidding the construction projects, finding the Vietnamese Construction Company to conduct their projects, providing technical consulting services ... Rent technical services from its own members operating in construction Project Management Consultant Architecture Office Rent technical services from other companies specializing in construction...
Ngày tải lên: 23/04/2013, 10:29
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... some factors greatly influencing aerobic granulation in a continuous-flow reactor We focused our attention on the controllable factors influencing the selection of well-settling sludge because ... Feeding Pattern on the Formation of Aerobic Granular Sludge As shown in Figs and 4, nitrification performance and sludge washout characteristics at continuous flow and sequencing batch modes (Runs and ... to 7.0 by adding NaHCO3, and the water temperature was maintained at 22 ± 2 C Gas-solid separator Vertical sectional view 4.7cm 13cm 20cm Sludge settling zone 25cm 5cm Effective volume: 7.5L Gas...
Ngày tải lên: 05/09/2013, 10:15
Tài liệu Training document for the company-wide automation solution Totally Integrated Automation (T I A) doc
... training: Industry electronics technician Energy electronics technician Mechatronic technician Industrial mechatronic technician Polymechanic ( Switzerland ) Electronic service technician ( Switzerland ... Interface for the PC (e.g PC- Adapter) PLC SIMATIC S7-300 with the CPU 315-2DP Example configuration: Power supply: PS 307 2A CPU: CPU 315-2DP MICROMASTER Vector with PROFIBUS module CB15 PROFIBUS cable ... NCM S7 PROFIBUS MPI- Interface for the PC (e.g PC- Adapter) PLC SIMATIC S7-300 with the CP 342-5DP Example configuration: Power supply: PS 307 2A CPU: CPU 314IFM PROFIBUS- Communication processor:...
Ngày tải lên: 25/01/2014, 09:20
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq
... - B - B ! (F ! B *"3 - B - * % ' # ) ": * HH C& CQ * # H4 :F @Q * 4'F FFQ + H& :4 &Q H C' Q * 4'F FFQ + 4& ( @Q (& H@ CQ * HH FFQ %C& CQ) %H@ CQ) , - B - B - B - B - - B % ) 7B - B - B - B ... ::H) 'C) :& 5 B B - B - - , B M8 M* %) - # , 3 , * 5 ; B -% B6 4@) " 1% 'F) * # # 7B - B - * / B -% @ * * * (@) B - # * % ) R ! ! B ) * 1% 'F) @F * , , ! B< B ) * 1% * " C F " 1% AB C: ) B ... B % ) - - # - ? @@ BB , & , , , "- % 4C: 5 4C' ) , B B - # * !7 B - B - B B B B 5; - - - - B -0 * B , - -7 B ! "+ B; - ' , % @' 'F H( & F' 4:' :F4 :F& 4 &C) * * B; - + F B6 # - % # ) B B - B B *"*7...
Ngày tải lên: 29/01/2014, 00:23
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... 2-aminopyridine, which can be used for fluorescence detection in HPLC MSn spectra of glycans containing sialic acids were acquired after methylesterification of sialic acid moieties All spectra were obtained ... tool for a ‘cell profiler’, and it is expected to be applicable for selection of cancer-speci c lectins and for quality control of stem cells before transplantation [12–15] Recently, we have constructed ... IGOT technology to identify glyco-biomarker candidates Evanescent-field fluorescence detection scanner Ex light B Cancer C Normal Cancer Normal Step Step Step Step Fig A schematic for glycan profiling...
Ngày tải lên: 16/02/2014, 08:20
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
... Assembling Accounting Competencies Chapter 8: Historical Context for Changes in Accounting Education*!page 135 Abstract of article, “Historical Context for Changes in Accounting Education” *The ... long-term consequences for both the quality and viability of accounting education and accounting research (e.g., reduced capacity to educate doctoral students, reduced research capacity, reduced terminally ... Focus more academic research on relevant practice issues • Objective 1.3: Enhance the value of practitioner-educator exchanges • Objective 1.4: Integrate accounting research into accounting courses...
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... 5¢-CAGGTCCAGGGCGTTCATCCTGGC CCGG-3¢, located in exon-4, and its nested (upstream) primer, 5¢-CCCCCCGAGAGATCCCCCATGTAGCGGG-3¢, located in exon-4 The two steps of PCR were performed according to the ... accession number P30519) (sense, 5¢-AGATCTATCCCTT GAGGCCTTGTCCGCTTG-3¢; antisense, 5¢-AAGCTTG CC GCAGGTCGCTGTCGCCTG-3¢; these contain a BglII site and a HindIII site, respectively) The genomic ... promoter constructs in YN-1 cells (Fig 7B) In contrast, hypoxia consistently increased the promoter activity of a construct, HRESV40, which contains four copies of HRE, but showed only marginal effects...
Ngày tải lên: 19/02/2014, 06:20
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
... which may create a barrier to vaccination for some people Private health insurance has gaps for vaccination coverage because it does not universally cover all ACIP-recommended vaccinations for children ... liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are ... chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection is declining...
Ngày tải lên: 06/03/2014, 01:20
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
... prevention coordinators CDC CHIP CI CIA CMS Centers for Disease Control and Prevention Children’s Health Insurance Program confidence interval enhanced chemiluminescence Centers for Medicare and Medicaid ... B Vaccination, 127 Hepatitis C Vaccine, 136 Feasibility of Preventing Chronic Hepatitis C, 136 Need for a Vaccine to Prevent Chronic Hepatitis C, 137 Cost Effectiveness of a Hepatitis C Vaccine, ... liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are...
Ngày tải lên: 06/03/2014, 01:20
Preparing for the Psychological Consequences of Terrorism: A Public Health Strategy ppt
... are crucial following a terrorism event, particularly in the case of chemical, biological, radiological, or nuclear terrorism when instruction will be critical for effective management Public communication ... potential for persistent psychological consequences is a concern Physiological responses to chronic stress can increase the risk of disease within the population The consequences for the public’s health ... the Psychological Consequences of Terrorism Contents Executive Summary Introduction: Rationale for a Public Health Response to the Psychological Consequences of Terrorism Charge to the Committee,...
Ngày tải lên: 06/03/2014, 05:20
Connect and Catalyse: A strategy for business innovation 2008-2011 pdf
... government-funded basic research organisations in the UK Comprised of the Engineering and Physical Sciences Research Council, the Economic and Social Research Council, the Scientific and Technical Facilities ... Research Council, the Natural Environment Research Council, the Arts and Humanities Research Council, the Biotechnology and Biological Sciences Research Council and the Medical Research Council ... and Physical Sciences Research Council and the Economic and Social Research Council It will develop innovative technology-enabled products and services to meet the increasing demand for independent...
Ngày tải lên: 06/03/2014, 19:20