a one step strategy for oxide ceramics

business model you a one-page method for reinventing your career

business model you a one-page method for reinventing your career

... Mikael Fuhr Mike Lachapelle Miki Imazu Mikko Mannila Mohamad Khawaja Natasja la Lau Nathalie Ménard Nathan Robert Mol Nathaniel Spohn Nei Grando Niall Daly Nick Niemann Nicolas De Santis Oliver Buecken ... Salis Maaike Doyer Maarten Bouwhuis Maarten Koomans Manuel Grassler Marc McLaughlin ffirs.indd Sec1:9 Marcelo Salim Marcia Kapustin Marco van Gelder Margaritis Malioris Maria Augusta Orofino Marieke ... pictures appear in the front pages, and their names appear below.1 Adie Shariff Afroz Ali AJ Shah Alan Scott Alan Smith Alejandro Lembo Alessandro De Sanctis Alexander Osterwalder Alfredo Osorio Asenjo...

Ngày tải lên: 29/05/2014, 14:38

257 411 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 ... GGTCGCTTCGACATARTCACG 200 nM 200 nM Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC ... DNA polymerases While the distribution of the effect of mutations on viral fitness has been reported for one animal RNA virus [6] and one plant RNA virus [7], thus far no data are available for...

Ngày tải lên: 20/06/2014, 01:20

10 396 0
Market analysis and developing a competitive marketing strategy for selling medical solid waste  wastewater treatment equipment to customers in vietnam

Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam

... 143 ABBREVIATIONS ADB Asian Development Bank AIC Advanced International Joint Stock Company APEC Asia – Pacific Economic Cooperation ASEAN Association of Southeast Asian Nations ATM Automatic ... expanding the total market and market share defense strategies Meanwhile, the market-challenger is always involved in attack strategies such as frontal attack, flank attack, encirclement attack, ... organizational purchasing process take place? After gaining concrete information about the organizational buying behavior, B2B marketers need to understand how an organizational purchasing department...

Ngày tải lên: 23/07/2014, 03:36

254 591 2
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt

Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt

... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... induce inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by the ... which may induce inflammation again, damage the lung, and finally result in fatal pneumonia and acute respiratory tract infection syndromes This indicates that influenza patients require both antiviral...

Ngày tải lên: 12/08/2014, 04:21

4 220 0
A content caching strategy for named data networking

A content caching strategy for named data networking

... Hosseini Farahabadi, Mr Sasan Safaie, Mr Hooman Shams Borhan, Mr Amir Mortazavi, Dr Abbas Eslami Kiasari They always supported me in any circumstances I would also like to thank all my flat mates during ... these five years Dr Mojtaba Ranjbar, Dr Mohammadreza Keshtkaran, Mr Hassan Amini, Mr Mehdi Ranjbar, Dr Hossein Eslami, Mr Sai Sathyanarayan, for making our home warm and joyful and for your kind ... Dr Yuda Zhao, Mr Nimantha Baranasuriya, Mr Girisha Durrel De Silva, Mr Kartik Sankaran, Mr Mobashir Mohammad, Mr Sajad Maghare I have been unwavering in their personal and professional support...

Ngày tải lên: 09/09/2015, 08:17

194 334 0
Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies

Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies

... cryopreservation better (Said, Agarwal et al 2006; Dirican, Ozgun et al 2008; Makker, Agarwal et al 2008) (Grunewald, Paasch et al 2001; Said, Grunewald et al 2005; Grunewald, Paasch et al 2006) ... The ease and low cost of MACS makes it suitable for routine use in prenatal diagnosis (Pongsritasana, Wongratanacheewin et al 2006) By first enriching for fetal cells using MACS against fetal specific ... antibodies against known cell surface markers are used for MACS The extensive research data available for blood cells mean that many of the blood cell population subsets have been isolated by MACS For...

Ngày tải lên: 11/09/2015, 09:59

382 295 0
Strategic thinking: A nine step approach to strategy and leadership for managers and marketers

Strategic thinking: A nine step approach to strategy and leadership for managers and marketers

... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... institutions, democracy, hierarchies and ways of thinking that have largely proved to be accurate This was because he had knowledge about changes that had already taken place at the time he made his predictions ... to images that are already familiar, like birds, animals or sports players (Buzan, 1993) The new information is easier to recall The new information can be 'parked' - as in a Microsoft or Mac 'window'...

Ngày tải lên: 15/03/2014, 15:33

159 1,2K 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

... DCI was performed after the original analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA was isolated and subjected to qRT-PCR for CK19, CEA, and beta-actin ... tissue is much harder compared with formalin fixed material and requires a special training The OSNA lysate can be asservated and in unclear cases RNA isolation for further diagnostics is possible ... levels for each of LN slices) RNA quality was assured by OSNA performed for beta-actin 139 samples gave a negative result and 37 samples gave a positive result with both methods (table 2) No isolated...

Ngày tải lên: 18/06/2014, 16:20

6 535 0
Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

... article as: Zhao et al.: A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials Nanoscale Research Letters 2011 6:71 Submit your manuscript to a journal ... CeO2, and TiO2 on a few-layer graphene earth metal oxides on MWNTs See Additional file (SI 5) for more details Conclusion In summary, we report a general strategy for synthesis of a large variety ... powder XRD pattern shown in Additional file (SI 3) One might expect formation of crystalline Er O NPs after thermal annealing The nanohybrid materials have many potential applications compared with...

Ngày tải lên: 21/06/2014, 06:20

5 355 1
Báo cáo hóa học: " Research Article A New One-Step Iterative Process for Common Fixed Points in Banach Spaces" ppt

Báo cáo hóa học: " Research Article A New One-Step Iterative Process for Common Fixed Points in Banach Spaces" ppt

... for asymptotically nonexpansive mappings in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 267, no 2, pp 444–453, 2002 10 W Takahashi, “Iterative methods for approximation ... M Nam, “Convergence and stability of iterative processes for a pair of simultaneously asymptotically quasi-nonexpansive type mappings in convex metric spaces,” Journal of Computational Analysis ... three -step iterative sequences with mixed errors for asymptotically quasi-nonexpansive mappings in Banach spaces,” Panamerican Mathematical Journal, vol 14, no 1, pp 45–54, 2004 J K Kim, K S Kim, and...

Ngày tải lên: 22/06/2014, 03:20

10 236 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

... contamination during sample preparation for post-PCR analysis Real-time RT-PCR assays have been widely utilized for early diagnosis of many other animal viral diseases [7,8] In this study a one- step ... dilutions; lane N: negative control having no template; lane M: DL2000 DNA ladder Maker (TAKARA) ing temperature (Tm) The thermal profile for melting curve analysis consisted of a denaturation for at ... were as follows: an initial reverse transcription for 30 at 50°C, followed by a PCR activation for at 94°C, 30 cycles of amplification (50 s at 94°C, 50 s at 56°C, and at 72°C), and a final extension...

Ngày tải lên: 12/08/2014, 04:20

7 350 0
Marketing Strategy for a Business Service Firm

Marketing Strategy for a Business Service Firm

... emphasis to a major function of management of organization Strategy and strategic management concepts help managers in the VFCFIs understand the important role of strategy in an organization Strategy ... implementing organizational strategy, and (5) exerting strategic control (See Figure 3.1) Step Environmental Analysis Step Establishing Organizational Direction Step Strategy Formulation Step4 Strategy ... economical and technological development in Vietnam and international markets, acts as agent for patents and registration of trade and service marks and for protection industrial and intellectual...

Ngày tải lên: 23/04/2013, 10:29

86 505 1
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

... and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration ... granular sludge used for characterization of sludge washout and retention was obtained from another AUFB reactor that had been operated using ammonia-rich wastewater Details of the granular sludge ... in an aerobic granular sludge reactor, Water Res., 39(12), 2676-2686 Standard Methods for the Examination of Water and Wastewater (1998) 20th edn, - 257 - American Public Health Association/American...

Ngày tải lên: 05/09/2013, 10:15

8 482 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

... for dial-up access, install Connection Manager Administration Kit and Phone Book Administrator on VPN1 Additionally, create a phone book and post it to the phone book server, and create a dial-up ... computer accounts for IIS1 and VPN1 IAS1 As part of setting up the basic infrastructure for the test lab, configure IAS1 as the RADIUS server that provides authentication, authorization, and accounting ... Paper IIS1 As part of setting up the basic infrastructure for the test lab, configure IIS1 as a Web server and a file server for the example.com domain Perform basic installation and configuration...

Ngày tải lên: 27/01/2014, 15:20

59 1,1K 0
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...

Ngày tải lên: 29/01/2014, 00:23

85 646 5
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated immunoassay ... Mahal LK (2007) A ratiometric lectin microarray approach to analysis of the dynamic mammalian glycome Proc Natl Acad Sci USA 104, 11534–11539 14 Tateno H, Uchiyama N, Kuno A, Togayachi A, Sato ... Ito H, Sato T, Shikanai T, Takahashi Y, Takahashi K & Narimatsu H (2005) A strategy for identification of oligosaccharide structures using observational multistage mass spectral library Anal Chem...

Ngày tải lên: 16/02/2014, 08:20

11 854 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

... qualified academic positions because of cultural barriers at universities that favor academically qualified professors There are few formalized mechanisms for accounting educators to maintain awareness ... need for a sustained focus on the many areas that impact accounting education and creating approaches that foster that continuous process Summary of Recommendations The paragraphs above provide a ... Develop a high school accounting class that is eligible for Advanced Placement (AP) credit • Map educational and career pathways in accounting • Advance community college accounting paraprofessional...

Ngày tải lên: 18/02/2014, 01:20

140 391 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative ... 487–495 35 Nakajima O, Takahashi S, Harigae H, Furuyama K, Hayashi N, Sassa S & Yamamoto M (1999) Heme deficiency in erythroid lineage causes differentiation arrest and cytoplasmic iron overload EMBO ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... Hepatitis, Iowa Department of Public Health, Des Moines, Iowa Brian J McMahon, Medical Director, Liver Disease and Hepatitis Program, Alaska Native Tribal Health Consortium, Anchorage, Alaska Martín ... Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog/12793.html Hepatitis and Liver Cancer: A National Strategy for Prevention...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination ... aminotransferase Hepatitis B core antibody Hepatitis B surface antibody Hepatitis C antibody Asian and Pacific Islander aspartate transaminase adult viral hepatitis prevention coordinators CDC CHIP CI CIA...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
w