Discovering dynamic protein complexes from static interacomes three challenges

... identification of the three challenges in complex discovery, is based on work published in Yong 15 CH, Wong L, From the static interactome to dynamic protein complexes: Three challenges , J Bioinform ... complex discovery We identify three challenges in protein- complex discovery that arise from, or are exacerbated by, this static view of PPIs and protein complexes M...

Ngày tải lên: 09/09/2015, 08:11

... transcription factors, NF -AT and AP-1 [18,22,26] Together, this indicates that the formation of multiprotein signaling complexes at LAT is crucial for linking LAT phosphorylation to the stimulation of ... function of the multiprotein complexes that occur at LAT Biophysical studies Recently, state -of -the- art biophysical methods have been used to examine...

Ngày tải lên: 23/03/2014, 15:21

... thesis A survey on computational methods for identifying conserved protein complexes between species: in this survey, computational methods for identifying conserved protein complexes are grouped ... present a definition for the problem of identifying conserved protein complexes between species from protein interaction data We then review t...

Ngày tải lên: 01/10/2015, 17:27

... thesis A survey on computational methods for identifying conserved protein complexes between species: in this survey, computational methods for identifying conserved protein complexes are grouped ... present a definition for the problem of identifying conserved protein complexes between species from protein interaction data We then review t...

Ngày tải lên: 03/10/2015, 21:56

... thesis A survey on computational methods for identifying conserved protein complexes between species: in this survey, computational methods for identifying conserved protein complexes are grouped ... present a definition for the problem of identifying conserved protein complexes between species from protein interaction data We then review t...

Ngày tải lên: 04/10/2015, 07:57

... X(D ⁄ E)YX (I ⁄ V ⁄ L)YXX(P ⁄ F) – – – SH2 domain TpXYp – – – RVXF FXXRXR – PXIXIT – – – – SH2 domain RRA(Sp ⁄ Tp)VA – E(Y ⁄ F ⁄ D)Yp RDXYXTDYYpR YpASI YpIDL – – Amino acids are indicated by the ... – – (Sp/Tp)XX(S ⁄ T) (D ⁄ E)XX(S ⁄ T) (S ⁄ T)XX(Sp ⁄ Tp) (S ⁄ T)XX(D/E) (S/T)XXX(Sp ⁄ Tp) RXRXX(S ⁄ T) (S ⁄ T)X(K ⁄ R) – – – – –...

Ngày tải lên: 18/02/2014, 08:20

... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... of heterologous ASP3c in P pastoris MALDI-TOF mass spectrum of recombinant ASP3c (Fig 4) showed a major Fig MALDI-TOF mass spectrometry analysis of the recombinant ASP3c secreted by Pichi...

Ngày tải lên: 21/02/2014, 03:20

... fragments of DNA, it is likely that at least some of the  17 genes of the family are spaced several kb apart (as for Afp-Lu1 and 2. 7a) , even though they may be linked In both Afp-Lu1 and Afp-Iu1, the ... ® Arg, Tyr89 ® Phe and Asn101 ® Ser) A putative TATA box was found at )79, but no evidence of a CAAT box could be found AFP-Iu1 had the same polyadenylation signal,...

Ngày tải lên: 21/02/2014, 15:20

... Pkg2 from Streptomyces granaticolor [9]; PpkA.pa, PpkA from P aeruginosa [31]; PknA.ana, PknA from Anabaena [7]; YpkA.yp, YpkA from Y pseudotuberculosis [10] [c-32P]ATP and either histone or myelin ... preincubated for 15 at room temperature with (lane 1), 0.5 (lane 2), (lane 3) and 2.5 (lane 4) mM sodium orthovanadate and then assayed for phosphorylation activity (E) Phosphoamino...

Ngày tải lên: 22/02/2014, 04:20

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

... available on protein folding intermediates [11–18], there are no reports available for E coli invasin protein IbeA The process of unfolding and refolding is useful for a complex unfolding transition, ... spectroscopic techniques to identify protein folding intermediates Protein folding intermediates Purification of IbeA The expression level of IbeA was 6–8 m...

Ngày tải lên: 07/03/2014, 05:20

... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...

Ngày tải lên: 07/03/2014, 11:20

... artificially introduced cross-links in proteins Cross-links impose distance constraints on amino acid residues that can be used to model the 3-D structure of proteins and protein complexes [3–7] Mass spectrometric ... structures, chemical modifications and cross-linking in protein mixtures, complexes, and assemblies Proteins A single protein, a list of p...

Ngày tải lên: 07/03/2014, 12:20