ELECTRICAL CHARACTERIZATION OF TWO DIMENSIONAL CARBON AND VO2 IN ULTRAHIGH VACUUM
... ELECTRICAL CHARACTERIZATION OF TWODIMENSIONAL CARBON AND VO2 IN ULTRAHIGH VACUUM WANG YING (B Eng., Hons., National University of Singapore, Singapore) A THESIS SUBMITTED FOR THE DEGREE OF ... doping.115,116 Besides, trapped impurities between the insulating substrate and 2D carbon can also bring additional challenges to obtaining the intrinsic electronic properties...
Ngày tải lên: 08/09/2015, 15:25
... of carbon before 2004 Nanotubes Graphite Sheets 1D 2D The most beautiful side of carbon Fullerene Amorphous Carbon 0D 3D The dark, soft and tough side of carbon The shining and hard side of carbon ... Structure of Two Dimensional Carbon 1.3 Carbon Nanowalls – Disordered 2D Carbon 1.3.1 Fabrication of Carbon Nanowalls 1.3.2 Structure and Morphology 11 1....
Ngày tải lên: 14/09/2015, 08:40
... SPECTROSCOPIC STUDIES OF TWO DIMENSIONAL CARBON NANOSTRUCTURES AND SEMICONDUCTOR QUANTUM DOTS Ni Zhenhua (B Sc Shanghai Jiao Tong University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... results on spectroscopic studies of two dimensional carbon nanostructures: graphene and carbon nanowalls (CNWs) It also includes the high pressure Raman and...
Ngày tải lên: 13/09/2015, 21:36
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
... pressure, and heart rate Conclusions Velocity Vector imaging (VVI) is a clinically feasible approach for strain measurements in infarcted myocardium allowing an accurate assessment of global and regional ... Duan Y, Yuan L, Yang Y Velocity vector imaging in assessing the regional systolic function of patients with post myocardial infarction Echocardiograph...
Ngày tải lên: 25/10/2012, 11:15
Proteomics approach on the identification of virulence factors of enteropathogenic and enterohemorrhagic escherichia coli (EPEC and EHEC) and further characterization of two effectors espb and nlei
... mechanisms of infection and to develop the diagnostics and therapeutics for these pathogens Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic Escherichia coli (EHEC) are two of the most ... insoluble and soluble fractions of HeLa cells after infected with the EPEC wild type and the espB mutant and detected with anti-Tir antibody 79 Fig...
Ngày tải lên: 15/09/2015, 17:09
Electrical spin injection and transport in two dimensional carbon materials
... SUMMARY Two- dimensional carbon materials including single and few layer graphene sheets are promising for spintronic applications due to their peculiar electronic properties, including small spin- orbit ... goal to build up a suitable interface to facilitate spin injection and transport in low dimensional carbon materials, and help realize energy efficient carbon...
Ngày tải lên: 10/09/2015, 09:11
Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt
... vivo state of rainbow trout HSF1, however, it remains to be elucidated whether the HSF1 isoforms of rainbow trout form heterotrimers in vivo Why are there two isoforms of HSF1 in rainbow trout? Although ... of the heat shock response and beyond FASEB J 15 , 11 18 11 31 Mosser, D.D., Heikkila, J.J & Bols, N.C (19 86) Temperature ranges over which rainbow tr...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... process of soybean seeds as decreases in the mRNA levels of GmPDIL-1, GmPDIS-1 [26] and GmPDIM [27] were observed during the accumulation of the storage proteins Expression of certain seed storage proteins ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot
... identity with HvTrxh1 and HvTrxh2 are present in the TIGR barley sequence database As only HvTrxh1 and HvTrxh2 have been identied so far in the barley seed proteome, the other thioredoxin h isoforms ... endosperm and embryo show in detail how HvTrxh1 and HvTrxh2 are distributed in these tissues HvTrxh1 from all three tissues is observed The relative intens...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo Y học: Purification and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures ppt
... growth and secreted AP activity of tomato suspension cells Tomato cells cultured for days in the absence of exogenous Pi had only approximately 40% of the fresh weight of the 8-day-old +Pi cells ... phosphoenolpruvate-hydrolyzing specific activity of 222 UÆmg)1 and a recovery of approximately 3%, whereas SAP2 was purified 50-fold to a final phosphoenolpruvate-hydrolyzing ac...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khóa học: Isolation and biochemical characterization of two soluble iron(III) reductases from Paracoccus denitrificans docx
... were eluted in two phases with 300 mL of linear gradient of 0–0.6 M NaCl and 50 mL of linear gradient of 0.6–1 M NaCl at a flow rate of 0.8 mLÆmin)1 Fractions of mL were collected and those displaying ... results of studies leading to the conclusion that at least two distinct soluble enzymes of P denitrificans exhibit an activity of Fe(III) reductase These enzymes...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: "Purification and characterization of two larval glycoproteins from the cattle tick, Boophilus annulatus" doc
... citatsomreht a ot detcennoc )nedewS ,aicamrahP( tinu IIrohpitluM eht ni demrofrep saw sisylana citerohportcele ehT la te gnisucof cirtceleosi lacitylanA snoitacifidom thgils htiw ]42[ nibwoT fo dohtem ... ,BKL( rettolb yrd-imes tolBavoN a gnisu demrofrep saw sisylana tolbonummI la te gnittolbonummI ]31[ ilmmeaL yb debircsed snoitidnoc eht ot gnidrocca demrofrep saw siserohportcele dna ,selpma...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo y học: "Detection and characterization of two chimpanzee polyomavirus genotypes from different subspecies" potx
... Detection and characterization of two chimpanzee polyomavirus genotypes from different subspecies Virology Journal 2010 7:347 Submit your next manuscript to BioMed Central and take full advantage of: ... human McPyV and TSPyV, the orangutan polyomaviruses and LPV from African green monkeys Interestingly, both rodent viruses (MuPyV and HaPyV) also fall within this...
Ngày tải lên: 12/08/2014, 02:20
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps
... Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were ... microscopy, structural basis of capsid stability and mRNA processing regulation Structure 20 03, 11 :6 51- 6 63 17 Yu X, Jin L, Zhou ZH: 3. 88A° structure of cyt...
Ngày tải lên: 12/08/2014, 04:20