Quantitative real time PCR

Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx

... Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR Cancer Cell International 2010 10:2 Publish with ... of 19 genes by qPCR The expression of 19 genes in test lung cancer cell lines (black and gray) and four validation cell lines (white)...

Ngày tải lên : 15/02/2014, 04:20

12
520
0

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata ... SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgc...

Ngày tải lên : 18/06/2014, 16:20

9
568
0

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

... Reference gene selection for quantitative real- time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections Virol ... of cell types infected with a variety of strains of HIV-1, HSV-1, VZV and cytomegalovirus (CMV) compared to mock infected cells Results A range of...

Ngày tải lên : 18/06/2014, 18:20

5
481
0

Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

... ideal reference gene in gene expression analysis has to be done for each individual experimental setting by evaluat- ing several genes and using the best two or three of these genes as reference ... synthesis was performed using µg of RNA, at 50°C Finally, cDNA was diluted 1:5 before use in QPCR Quantitative TaqMan PCR Primers, TaqMan probes and QPCR conditions for...

Ngày tải lên : 18/06/2014, 22:20

5
452
0

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

... Reference gene selection for quantitative real- time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections Virol ... of cell types infected with a variety of strains of HIV-1, HSV-1, VZV and cytomegalovirus (CMV) compared to mock infected cells Results A range of...

Ngày tải lên : 20/06/2014, 01:20

5
574
0

báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

... ideal reference gene in gene expression analysis has to be done for each individual experimental setting by evaluat- ing several genes and using the best two or three of these genes as reference ... synthesis was performed using µg of RNA, at 50°C Finally, cDNA was diluted 1:5 before use in QPCR Quantitative TaqMan PCR Primers, TaqMan probes and QPCR conditions for...

Ngày tải lên : 20/06/2014, 04:20

5
539
0

báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt

... understanding the molecular pathways involved in both modes of reproduction The identification of genes involved in apomictic development will open the possibility of controlling the expression of ... to the biotechnological interest of controlling the process of cloning through seeds The occurrence of both apomictic and sexual reproduction within...

Ngày tải lên : 12/08/2014, 03:20

10
267
0

báo cáo khoa học: " Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida" pot

... al.: Validation of reference genes for quantitative real-time PCR during leaf and flower development in Petunia hybrida BMC Plant Biology 2010 10:4 Submit your next manuscript to BioMed Central and ... both lines In contrast, the suggested genes did not coincide and were EF1a and SAND in Mitchell, whilst CYP and RAN1 were the genes of choice in...

Ngày tải lên : 12/08/2014, 03:21

11
330
0

Báo cáo khoa học: "Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe" pps

... 29.63 0. 21 0.70 1. 00E+04 33.07 0. 31 0.92 1. 00E+03 36.33 0. 31 0.84 1. 00E+02 39.50 0 .17 0.44 1. 00E+ 01 42.67 0.32 0.75 1. 00E+08 19 .70 0.28 1. 41 1.00E+07 1. 00E+06 23.09 26. 31 0.47 0.32 2.03 1. 23 1. 00E+05 ... ± 0 .19 8 .18 ± 0.08 3d 7.88 ± 0 .19 7.52 ± 0.07 7.78 ± 0 .11 7.5 ± 0.08 7.52 ± 0 .15 7. 91 ± 0.27 7. 41 ± 0 .19 7. 81 ± 0. 21 7.84 ± 0 .10 8 .12 ± 0.06 7....

Ngày tải lên : 12/08/2014, 04:21

10
293
0

Báo cáo y học: "Endothelial Cytomegalovirus infection monitored by quantitative real-time PCR in critically ill patients" pps

... http://ccforum.com/content/15/2/412 Page of Figure Cytomegalovirus plasma load measurements during ICU stay of four severe burn patients Table Patient characteristics Patient Age (years) TBSA (%) 80 76 a DBSA (%) ... 30 9,130 Discharged from ICU 141 63,400 Died in ICU 133 130,000 Discharged from ICU 105 137,000 Died in ICU ICU stay (days) Viremia peak is expressed in copies/ml DBSA, d...

Ngày tải lên : 14/08/2014, 07:21

2
480
0

Báo cáo sinh học: "Quantitative real-time PCR study on persistence of pDNA vaccine pVax-Hsp60 TM814 in beef muscles" pptx

... Levels of pDNAX detected by QRTPCR in calf muscle (at the injection site) after administration of 10 μg pDNAX in 5-week Levels of pDNAX detected by QRTPCR in calf muscle (at the injection site) ... (QRTPCR) assay was developed to assess a residual pDNA vaccine pVAX-Hsp60 TM814 in mice and beef cattle In beef cattle, ultra low residual level of pDNA vaccine wa...

Ngày tải lên : 14/08/2014, 19:22

11
333
0

Quantitative real time PCR

... publication of quantitative real- time PCR) guidelines were published in 2009 with the twin aims of providing a blueprint for good real- time quantitative polymerase chain reaction (qPCR) assay design ... for the publication of quantitative real- time PCR) guidelines [1] represent a major milestone in the transformation of the real- time quantitative polymerase chain rea...

Ngày tải lên : 05/09/2015, 10:35

233
730
0

Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

... Similarly, synovial fluid can be obtained relatively easily by joint aspiration but its utility is markedly diminished by the fact that the volumes are highly variable and effusions are frequently ... measuring gene expression in target tissue The use of a cellular standard generated with activated PBMC cDNA significantly improves assay reliability by reducing variation and by...

Ngày tải lên : 09/08/2014, 01:23

9
557
0

Luận văn :Định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR

... xây dựng phương pháp định lượng kháng nguyên kỹ thuật - Real-time PCR kỹ thuật phage display - Đã ứng dụng kỹ thuật định lượng kháng nguyên để xác định nồng độ Cyfra2 1-1 số mẫu huyết nhận từ ... dòng lực với kháng nguyên Cyfra 21-1 giếng Do đó, giá trị OD có ý nghĩa xác định bán định lượng nồng độ kháng nguyên Cyfra 21-1 Như vậy, giếng khay ELIS...

Ngày tải lên : 29/10/2012, 13:26

47
838
1

Kỹ thuật Real time PCR chẩn đóan sớm HIV trên trẻ em

... hóa Đánh giá Kỹ thuật real time PCR Để chẩn đoán sớm, giá thành thấp trẻ sinh từ mẹ nhiễm HIV Agence Nationale de recherches sur le Sida et les hépatites virales Kỹ thuật « Real- time PCR » có độ ... DNA PCR So sánh với kỹ thuật real time RT PCR thực gene LTR (theo ANRS protocol) • Mẫu bệnh phẩm: • Huyết nhóm trẻ chẩn đoán HIV (+) nhóm trẻ HIV( -...

Ngày tải lên : 17/11/2012, 09:05

7
1.3K
10