Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

... iii Synthetic Progress Toward Parvistemonine, Spiroxins A and B, and Generation of Palmarumycin Analogues Erika Elaine Englund, PhD University of Pittsburgh, 2008 Natural products can both challenge ... Structure of parvistemonine (1) The source of Stemona alkaloids are the Stemona plants, also known as Roxburghia They are found in South Asia, Malaysia and No...

Ngày tải lên: 23/08/2015, 17:30

289 518 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo y học: " A murine leukemia virus with Cre-LoxP excisible coding sequences allowing superinfection, transgene delivery, and generation of host genomic deletions" pptx

Báo cáo y học: " A murine leukemia virus with Cre-LoxP excisible coding sequences allowing superinfection, transgene delivery, and generation of host genomic deletions" pptx

... ctgggtggcccaatcagtaagtccgagtc Akv-2XY Akv -Y a SfuI SpeI Env-aagttcgaa-LoxP-actagtgcggccgtttagtgaataaaagattttattcagtttacagaaagagggggg-3’LTR Env-aag attttattcagtttacagaaagagggggg-3’LTR ... AYGC.2C3 AYGC.3B2 Akv -Y Akv -Y Akv -Y Akv -Y A A B C 0.6 1.0 0.6 2.5 1 2–3 A2 XYGC. 2A2 A2 XYGC.2B1 A2 XYGC.2C1 A2 XYGC.3B1 A2 XYGC.3B3 A2 XYGC.3B8 Akv-2XY Akv-2XY Akv-2XY Akv-2XY Akv-2XY Ak...

Ngày tải lên: 13/08/2014, 13:20

14 211 0
Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf

Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf

... type of specifications, each of which is optional except for the name of the exemplar: • Name: Specification of the name of the exemplar • Parameters: Specification of the arguments passed in parameters ... relation of elaboration and to specify syntactic conjunction Exemplar: [ Name: soft-description Param: [ $SOFT ] Const: [ AND [ title ( $SOFT ) paragraph-break ( ) object-t...

Ngày tải lên: 08/03/2014, 05:21

5 419 0
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

... find all the steady states of the system [15] Generalized logical analysis allows us to find all the steady states of a discrete dynamical system by evaluating the functionality of the feedback ... semi-quantitative dynamical models provide valuable information about the global properties of regulatory networks The stable steady states of a dynamical system...

Ngày tải lên: 13/08/2014, 23:20

18 288 0
600 sentences of certificate A and B

600 sentences of certificate A and B

... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of < /b> things are taken away a < /b> is b broken c off d away ... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a <...

Ngày tải lên: 05/11/2012, 09:18

280 886 3
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... 14-48 form the small insertion domain that comprises a short a- helix and a three-stranded anti-parallel b-sheet; the remaining protein residues form the (a ⁄ b)8 barrel domain and a C-terminal extension ... would act as a regulatory link between glycolysis and NAD synthesis The structure of hACMSD in complex with DHAP may used for the design o...

Ngày tải lên: 18/02/2014, 06:20

9 796 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... to and degrade individual polymer chains First, the chains are degraded by both endochitinases, that attack the chitin chain randomly, and exochitinases, that attack the chitin chains from either ... 24 h of incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a- and b-chitin The degr...

Ngày tải lên: 18/02/2014, 08:20

14 683 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... Furthermore, these data may be of particular importance in understanding the physiological role of b-glycosidases and in designing inhibitors In addition, another important issue in understanding the aglycone ... details about the role of different residues of the aglycone-binding site in the stabilization of ESà and the interdependence between t...

Ngày tải lên: 18/02/2014, 17:20

12 732 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... was of interest to shed some light on the changes of the molecular architecture of the two domains of vertebrate MT when Cu(I) is added to them For this task, the synthetic murine aMT-1 and bMT-1 ... increase of intensity was observed until the addition of the third and fourth Cu(I) ions to the a- and b-domain, respectively Further Cu(I) addi...

Ngày tải lên: 07/03/2014, 09:20

14 485 0
Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc

Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc

... Johansson et al on global protein dynamics, with the goal of further defining a potential mechanism of volatile general anesthetic action Results Binding of the volatile anesthetic halothane to the ... yields a Kd of 0.46 ± 0.10 mm and a Qmax of 0.17 ± 0.01 Binding of the volatile anesthetics halothane and isoflurane to the porcine odora...

Ngày tải lên: 07/03/2014, 16:20

9 421 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... TGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT ... ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagC...

Ngày tải lên: 08/03/2014, 08:20

12 507 0
w