... categorize and define questions. In “Practical English Usage”, questions are classified into 4 main types (Swan, 2003): Nguyen 1 An Overview into the Semantic of Questions in English and Vietnamese Student: ... between the form and the meaning of a sentence (Thiêm, 2004). Comparing and contrasting questions in terms of their semantics enab...
Ngày tải lên: 22/01/2013, 09:28
... These questions are referred to as hard questions . This paper examines seven types of hard questions you are likely to see on the CISSP examination and the best approaches for solving them. Throughout ... of Hard CISSP Exam Questions and How To Approach Them 1-800-COURSES www.globalknowledge.com Expert Reference Series of White Papers Introduction T...
Ngày tải lên: 22/10/2013, 15:15
HOW TO IMPROVE LISTENING SKILLS IN TOEIC THE CASE OF questions and responses short conversations
... at role of listening in communication and TOEIC test in order to find out better methods to improve listening skill in TOEIC test level 2, the case of: questions- responses and short conversations. ... listening skills in TOEIC test. 3. Scope of the study In fact, there are lots of various methods to improve listening skills in...
Ngày tải lên: 11/12/2013, 23:59
The great book of questions and answers
... pull of the Sun and Moon, and the difference in temperature and salt content of the water. These movements form strong currents in the oceans, both at the surface and deep down. Oceans of the ... image shows some of the bigger moons and the gossamer rings around the planet. The solar system The relative sizes of the eight planets and the three d...
Ngày tải lên: 27/12/2013, 15:30
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... schematic example of how protein aggregation and amy- loid fibril formation prediction software might be used for fine-tun- ing and control of protein solubility in bacterial IBs is shown. (A) The amino ... bias specific to the available data, the authors of waltz Table 1. Protein aggregation and amyloid fibril formation prediction servers (URLs)...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... third activity of P450c17, in the formation of an androstenol precursor Role of recombinant cytochrome b 5 and P450 reductase Penny Soucy, Lucille Lacoste and Van Luu -The Molecular Endocrinology and ... synthesis of 1 7a- OHpreg or DHEA, we performed enzymatic assays using human and porcine P450c17 in the presence of various substrates – preg, 1 7...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Stability and fibril formation properties of human and fish transthyretin, and of the Escherichia coli transthyretin-related protein potx
... Stability and fibril formation properties of human and fish transthyretin, and of the Escherichia coli transthyretin-related protein Erik Lundberg 1 , Anders Olofsson 2 , Gunilla ... with the thermostability of its tetrameric and monomeric structures. Thermostability and protein structures We have analyzed the structures of hTTR (Protein Data...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... H61T VAO, and H61T holo-VAO and H42 2A holo-VAO, both containing noncovalently bound FAD, revealed that binding of FAD and formation of the covalent FAD–protein bond do not cause any significant ... on elucidating the mechanism(s) of covalent flavin incorporation (flavinyla- tion) and the possible role( s) of covalent protein–flavin bonds. These endeavors have...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... 5Â-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3Â and 5Â-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, and 5Â-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACCCGG GATATCTTTATCGTC ... insertion of < /b> the annealed fragment of < /b> the synthesized oligonucleotides, 5Â-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGC...
Ngày tải lên: 16/03/2014, 05:20
Formation of silicon oxide nanowires directly from au si and pd–au si substrates
... general morphologies of the thermally heated Au deposited Si (0 0 1) [Au/ Si] and Pd Au deposited Si (0 0 1) [Pd Au/ Si] substrates in the tube furnace. As shown in Fig. 1(a) ,Au nanoislands with diameters of 10–80 ... 2006 Abstract Amorphous silicon oxide (SiO x ) nanowires were directly grown by thermal processing of Si substrates. Au and Pd Au thin films...
Ngày tải lên: 16/03/2014, 15:16
Báo cáo khoa học: Kinetics of intra- and intermolecular zymogen activation with formation of an enzyme–zymogen complex ppt
... for each of these mechanisms with the experimental results, these authors suggested a reaction mechanism inclu- ding both intra- and intermolecular activation of the zymogen by the action of the ... route of intramolecular activation of the zymogen into the active enzyme, E, and one or more peptides represented by W [route (a), Scheme 3] [12,22,25–27] and a route...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot
... Central Page 1 of 10 (page number not for citation purposes) Theoretical Biology and Medical Modelling Open Access Research Mathematical model of blunt injury to the vascular wall via formation of rouleaux ... the internal wall [16], also creating conditions for atheromatosis. Therefore, our understanding of the mechanism of blunt trauma to...
Ngày tải lên: 13/08/2014, 22:22