The following is a list of colours. A number of the color swatches below are taken from domainspecific naming schemes such as X11 or HTML4. RGB values are given for each swatch because such standards are defined in terms of the sRGB color space. It is not

báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

... to be viable and uncontaminated To assure viability and sterility, a vial was recovered from the freezer and passaged times and then tested for mycoplasmal, bacterial and fungal contaminants Six ... cultured from venous ulcers display cellular characteristics of senescence J Vasc Surg 1998, 28:876-883 Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga...

Ngày tải lên: 18/06/2014, 15:20

9 487 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

... motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions Interestingly, this alanine-rich sequence, ... Gld2 Rbm9 interaction (Fig 2B) However, the RRM-containing central domain of hRbm9 (amino acids 48–269) and amino acids 269–350 of hRbm9 are not able to mediate the binding These...

Ngày tải lên: 07/03/2014, 05:20

14 502 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing featu...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

... N-acetylglucosamine (NAG) and plate confrontation assays with the plant pathogen R solani at the time points before contact, during contact and after contact of the mycelia and H atroviridis alone on plates ... Results Analysis of the secretome of H atroviridis during cultivation on glucose Hypocrea atroviridis was grown on glucose, and the culture supernatan...

Ngày tải lên: 07/03/2014, 12:20

14 494 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACA...

Ngày tải lên: 07/03/2014, 15:20

8 485 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx

... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... that the NADP+ oxidation reaction is highly regiospecific Kinetics of NADPO formation as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation...

Ngày tải lên: 16/03/2014, 11:20

10 406 0
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

... protein (BNIP3) is a member of a unique subfamily of death- inducing mitochondrial proteins [14,15] BNIP3-induced cell death has been characterized by early plasma membrane and mitochondrial damage ... glutamate-induced excitotoxicity BNIP3 is a BH3-only proapoptotic member of the Bcl-2 family However, unlike in other members of the Bcl-2 family, t...

Ngày tải lên: 22/03/2014, 17:20

9 388 0
This pdF is a sample of the trend database & Monthly Snapshot potx

This pdF is a sample of the trend database & Monthly Snapshot potx

... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... TREND DATABASE » TREND DATABASE M SA E PL Keyword search the Database Filter trend examples by industry by trends, industries & time Full list of Tre...

Ngày tải lên: 23/03/2014, 12:20

27 325 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

... two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1fi3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus glycopeptides ... glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopep...

Ngày tải lên: 23/03/2014, 13:20

11 563 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... 4242 analysis This approach identified the Promyelocytic Leukemia Zinc Finger (PLZF) gene as a putative gene target of CUX1 PLZF was originally identified as a t(11;1 7) reciprocal chromosomal translocation ... Chip1up primer (5¢-aagctccagagggtctgcac-3 ) and Chip1dw primer (5¢-gaaaggcatcccgaacgcat-3 ); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3 ) and Chip2dw p...

Ngày tải lên: 29/03/2014, 21:20

13 359 0
w