Synthesis of the Anti-influenza Drug Oseltamivir Phosphate (Tamiflu)
... aziridination • origin of the chirality: asymmetric allylic alkylation Trost B M.; Zhang, T Angew Chem Int Ed 2008, 47, 3759 –3761 141 Synthesis of the Anti-influenza Drug Oseltamivir Phosphate (Tamiflu®) ... study for the synthesis of the Corey’s intermediate Corey’s intermediate is synthetised by a base catalyzed Diels-Alder reaction • starting material: 3-hydroxy-...
Ngày tải lên: 17/04/2015, 08:59
... tissue, (insets) CsA-treated Fabry (A, B) Heart – endothelial staining in Fabry mouse; (C, D) lung – epithelial cell staining increased in Fabry mouse; (E, F) brain microvascular endothelial staining ... Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al (2002) Production in yeast of alpha-galactosidase A, a...
Ngày tải lên: 19/02/2014, 07:20
... A L Barab´ si 2000 The large-scale organization of a metabolic networks Nature, 406:651-654 R Jakobson and M Halle 1956 Fundamentals of Language, The Hague: Mouton and Co P Ladefoged and I Maddieson ... us assume that the inventory of all the languages comprises of 21 consonants We further assume that the consonants are arranged in their hierarchy of preferen...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Crystal structure of the tetrameric inositol 1-phosphate phosphatase (TM1415) from the hyperthermophile, Thermotoga maritima docx
... rotation of the monomers in individual dimers In the center there is a schematic of the mutual relationship of the monomers, in selected members of the family, as indicated by the twist angle of the ... nonarchaeal IMPases The superposition of the second subunit of the MJ0109 structure (1G0H) after superposition of the first subunit requires a rotation...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo hóa học: " Sound Synthesis of the Harpsichord Using a Computationally Efficient Physical Model" potx
... partial In practice, the offset ranges from practically Hz to a few Hertz The gain of the resonator, that is, the amplitude of the beating partial, is set to be the same as that of the partial ... further in Section of this paper The idea is to include in these samples the sound of the quill scraping the string plus the beginning of the attack of th...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo khoa học: "Techniques for controlled synthesis of the Douglas-fir - Laccaria laccata ectomycorrhizal symbiosis" docx
... provide the carbon needed for the fungal growth (Harley and Smith, 1983) The release of these substances is linked to photosynthesis (Hacskalylo, 1973) Therefore, in order to obtain normal photosynthesis, ... between the plant and the fungus HowevVilmorin er, due to the limited volume of the vessel containing the roots, they are not suitable for the plant expression...
Ngày tải lên: 08/08/2014, 23:22
báo cáo khoa học: " BYPASS1: synthesis of the mobile root-derived signal requires active root growth and arrests early leaf development" ppsx
... bps1 roots (including the primary) expand radially, and this radial growth might also sustain synthesis of the bps1 signal bps1 signal transmission Movement of the bps1 signal from the root to the ... doi:10.1186/1471-2229-11-28 Cite this article as: Van Norman et al.: BYPASS1: synthesis of the mobile root- derived signal requires active root...
Ngày tải lên: 11/08/2014, 11:21
Total synthesis of the potent antibiotic platensimycin
... high-yielding synthesis of the aromatic unit (1-151) of 284 platensimycin Scheme 5.9 Preparation of the C6-methoxy analog (5-60) of (-)- 286 platensimycin Scheme 5.10 Completion of the total synthesis of ... between the benzoic acid and the four critical amino acid residues 1.4 Biosynthesis of Platensimycin By understanding the biosynthetic pathways leadi...
Ngày tải lên: 10/09/2015, 08:39
The NR4A orphan nuclear receptors are target genes of the novel drug c1 in cancer cells and potential mediators of drug induced apoptosis
... Accordingly, the great and urgent need presently is to investigate the role of each of the plenitude of genes and proteins important in the progression of cancer NUCLEAR RECEPTORS The nuclear receptors are ... Tan, Shazib Pervaiz, The NR4A orphan nuclear receptors are target genes of the novel drug C1 in cancer cells and...
Ngày tải lên: 14/09/2015, 14:04
Detection of Antiviral Drugs Oseltamivir Phosphate and Oseltamivir Carboxylate in Neya River, Osaka, Japan
... owing to H1N1 influenza pandemic and drastic increase in antiviral drugs consumption It is therefore worthy to monitor the drugs in surface waters in the winter season to get more insight of ... location of the sampling sites with the map of Japan inset The Neya River is located in Osaka Prefecture of Japan as shown in the figure Details of the sampling stati...
Ngày tải lên: 05/09/2013, 10:15
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
... exposure of liver cells to FFAs Interruption of TAG synthesis in conditions of excess availability of SFAs is the key point in the molecular mechanism of SFA-induced lipotoxicity It is suggested ... constitutes the initiating event in the process of lipotoxicity Stearate has to be activated in order to be toxic The first enzyme involved in me...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx
... to the 9th cycle from the N-terminus including the initiating Met: MHKTHSTMS for Sno1p and MTGEDFKIKS for Snz1p Properties of the complex of Sno1p and Snz1p When Sno1p with a His-tag and Snz1p ... SNO3, SNZ2 and SNZ3 complement the defect The relationship of all of these genes remains to be clarified Expression and purification of Sno1p and Snz1p In light...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on th...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx
... recently introduced for the preparation of C-6 aldehyde derivatives of Glc [15] The key step is the use of Collins reagent for the selective oxidation of the primary trimethylsilyl ether of the ... RESULTS Synthesis of inhibitors The synthesis and characterization of compounds 1b, 1d, 1f, 1g and 3b (Scheme 1) is reported for the first time, and the...
Ngày tải lên: 21/02/2014, 01:21