Development of a method to measure consumer emotions associated with foods
Development of a method to measure consumer emotions associated with foods
... emotions associated with foods maximizing information about the product. 2. Identify scaling approaches to measure emotions with consumers. 3. Develop a test protocol to evaluate food and measure emotions. ... techniques which are appropriate for the academic laboratory research might not be appropriate for commercial settings of consumer laboratories. Aca- demic la...
Ngày tải lên: 03/04/2013, 21:07
Báo cáo " A method to construct flood damage map with an application to Huong River basin, in Central Vietnam" pdf
...
Ngày tải lên: 05/03/2014, 16:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... FEBS Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osa...
Ngày tải lên: 18/02/2014, 17:20
Development of Applied Microbiology to Modern Biotechnology in Japan
Ngày tải lên: 26/10/2013, 02:20
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
Ngày tải lên: 28/10/2013, 11:15
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... off-resonance, resonance, mirror with and without perma- nent magnets, have been widely used to produce heavy and multiply charged ion beams to confine the plasma axially as well as radially (Alton & ... is capable of producing off-resonance, mirror, and flat magnetic field configurations. A mirror ratio of 1·1 and a maximum flat field of 1400 G has been obtained. The measured v...
Ngày tải lên: 22/12/2013, 08:58
Tài liệu Exporting the Results of a Query to an Array pdf
... Team LiB ] Recipe 5.12 Exporting the Results of a Query to an Array Problem You need to export the results of a query to an array in a manner similar to the GetRows( ) method of the ADO ... Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected from the table...
Ngày tải lên: 26/01/2014, 10:20
Development of supplementary materials to improve reading skills for the first year english majors at military science academy
... 30% >+)$ B 13% 12% 46% 29% a. various: 13% b. useful: 12% c. inadequate to improve reading skills: 46% d. monotonous: 29% &;+)$ ... : =;>?( 80% 20% a. at h...
Ngày tải lên: 29/01/2014, 14:39
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf
... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interacti...
Ngày tải lên: 15/02/2014, 01:20