0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Tự động hóa >

On line tuning of a neural PID controller based on variable structure RBF network

Báo cáo khoa học:

Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

... automatically enrich the output of a parser with information that is not provided by the parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and ... labelling, but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover the Penn functional tags automatically ... pattern and the features of all the nodes involved We trained a separate classifier for each pattern For evaluation purposes we extracted all occurrences of the patterns and the features of their...
  • 8
  • 379
  • 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... V a aspis, V a zinnikeri, and the remaining four clones having an intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation...
  • 10
  • 451
  • 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

... plasmid The gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ ... that displays many of the structural stability characteristics of cB crystallin and most of the surface characteristics of bB2 crystallin In addition, this new protein, which we call Gambeta, ... the intention of adding these to Gambeta later if a great variation in behavior was seen between bB2 and Gambeta However, as this was not the case, the Gambeta variant incorporating L and N at...
  • 13
  • 430
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Discriminative Training of a Neural Network Statistical Parser" pdf

... for part -of- speech tagging In Proc Conf on Empirical Methods in Natural Language Processing, pages 133–142, Univ of Pennsylvania, PA Adwait Ratnaparkhi 1999 Learning to parse natural language ... criteria the neural networks are trained to optimize Two of the neural networks are trained using the standard maximum likelihood approach of optimizing the same probability which they are estimating, ... paper has also proposed a neural network training method which optimizes a discriminative criteria even when the parameters being estimated are those of a generative probability model This training...
  • 8
  • 408
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to...
  • 13
  • 456
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury" ppt

... Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury Journal of NeuroEngineering and Rehabilitation ... Access Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury José-Antonio Gil-Gómez1*, ... mind: obtaining a valid and adaptive system for the balance rehabilitation of the patients, achieving a system that reinforces the motivation of the patients during the rehabilitative process and...
  • 10
  • 732
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... the Association for Assessment and Accreditation of Laboratory Animal Care International A viable lethal mouse model for Marburg virus is critical to the filovirus vaccine research program to...
  • 13
  • 431
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Design of Experiments for Performance Evaluation and Parameter Tuning of a Road Image Processing Chain" ppt

... vehicle CAN bus As the first tests performed by the industrial car part supplier FAURECIA demonstrated that a static tuning is ineffective against road image variability, an automatic and adaptive tuning ... illustrate our approach for IPC tuning on a road image processing chain This application will also help us to introduce practical details of the methodology Naturally, input and output image evaluations ... Lucas, A Domingues, D Driouchi, and P March´ , “Modele ing, evaluation and control of a road image processing chain,” in Proceedings of the 14th Scandinavian Conference on Image Analysis (SCIA...
  • 10
  • 460
  • 0
Báo cáo y học:

Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx

... al.: Assessing the efficacy of a modified assertive community-based treatment programme in a developing country BMC Psychiatry 2010 10:73 Submit your next manuscript to BioMed Central and take ... occupational therapy assessments and coordination of medication issuing One major disadvantage of the teams’ location was the historical, custodial reputation of state institutions The team therefore ... is against this backdrop that the state psychiatric management team in the Western Cape Province, South Africa, introduced an assertive community treatment program for each of the three regional...
  • 8
  • 310
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Improved Efficacy of a Gene Optimised Adenovirus-based Vaccine for Venezuelan Equine Encephalitis Virus" ppsx

... universally applicable [43] Gene optimisation has shown promise for a number of infectious diseases For example, ad-based malaria vaccines have been developed containing malarial antigens optimised ... adaptation, optimal for mammalian expression One measure of codon quality is the Codon Adaptation Index (CAI), a measurement for the relative adaptiveness of the codon usage of a gene towards ... important information to inform the design of vaccines for VEEV, which may be applied to preclinical VEEV vaccines such as ad-based vaccine [14], DNA vaccines [19-21], and sindbis virus-based vaccine...
  • 8
  • 267
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Improved Efficacy of a Gene Optimised Adenovirus-based Vaccine for Venezuelan Equine Encephalitis Virus" pdf

... universally applicable [43] Gene optimisation has shown promise for a number of infectious diseases For example, ad-based malaria vaccines have been developed containing malarial antigens optimised ... adaptation, optimal for mammalian expression One measure of codon quality is the Codon Adaptation Index (CAI), a measurement for the relative adaptiveness of the codon usage of a gene towards ... important information to inform the design of vaccines for VEEV, which may be applied to preclinical VEEV vaccines such as ad-based vaccine [14], DNA vaccines [19-21], and sindbis virus-based vaccine...
  • 8
  • 260
  • 0
Báo cáo y học:

Báo cáo y học: "Validation of a continuous, arterial pressure-based cardiac output measurement: a multicenter, prospective clinical trial" pot

... difference in cardiac output as a function of mean cardiac output Mean difference in cardiac output, measured by arterial pressure-based carmean cardiac output diac output (APCO) and intermittent ... accurately assess cardiac output during changing of the vascular tone [6,7] A new arterial pressure-based cardiac output (APCO) device uses access to the radial or femoral artery via a standard arterial ... output, cardiac index, stroke volume, and mean arterial pressure, ranges are ± standard deviations bMean cardiac output as measured by arterial pressure-based cardiac output Table Most frequent patient...
  • 7
  • 395
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Anti-tumor effects of a human VEGFR-2-based DNA vaccine in mouse models" pps

... the alginate-encapsulate tumor cell assay Angiogenesis in alginate implants was quantified by measuring the uptake of FITC-dextran into the beads Vascularization of alginate beads was apparently ... delivered by an attenuated strain of Salmonella typhimurium[29] Plasmid DNA vaccines are attractive because they are relatively easy to engineer and produce, and are safe to administer to humans [8-10] ... Plasmid DNA vaccines are attractive because they are relatively easy to engineer and produce, and are safe to administer to humans [8-10] A number of studies have reported the use of plasmid DNA- based...
  • 10
  • 338
  • 0
On line tuning of a neural PID controller based on variable structure RBF network

On line tuning of a neural PID controller based on variable structure RBF network

... to as dynamic orthogonal structure adaptation (DOSA) algorithm The algorithm can achieve compact network structure by employing a small number of parameters It takes advantage of a sliding data ... constructed by DOSA algorithm can react to the change of ship dynamics adaptively On- Line Tuning of a Neural PID Controller 1103 Conclusion With regard to the problems of controlling nonlinear system ... we apply the PID controller with variable structure RBF network in ship course control simulation The RBF network was on- line constructed by DOSA algorithm Simulation of ship course control was...
  • 11
  • 456
  • 0
Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system

Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system

... DEVELOPMENT OF A GRAPHIC USER INTERFACE BASED ON OPENGL FOR A DROP -ON- DEMAND MICRO/ BIO FABRICATION SYSTEM CHEN JUEXUAN (Ms.) (B.Eng.), HUST A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... additional functions for the GUI, simulation and monitoring based on OpenGL As a common graphic interface developed by SGI [23], OpenGL allows the advanced graphical output and utilizes Its interface ... printers, and household appliances In contrast to typed command labels, text -based interfaces or text navigation, a GUI has established a model containing the information and actions, and also supplied...
  • 78
  • 383
  • 0

Xem thêm

Từ khóa: anatomy of a video game controllerdiscriminative training of a neural network statistical parserdesign of a fuzzy temperature controllerneuro knowledge model based on a pid controller to automatic steering of shipsprofile tolerance of a linethe standard form of the equation of a linethe balance of payments of a country on current account is equal toa neural network model of lexical organisationvapor pressure of a liquid depends onpressure of a liquid depends onvapor pressure of a liquid depends on what factorvapour pressure of a liquid depends onthe saturated vapour pressure of a liquid depends on whatvapor pressure of a liquid in a closed container depends onwhat does the vapor pressure of a pure liquid depend onNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ