On line tuning of a neural PID controller based on variable structure RBF network

... automatically enrich the output of a parser with information that is not provided by the parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and ... labelling, but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover...

Ngày tải lên: 08/03/2014, 04:22

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

... plasmid The gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ ... that displays many of the structural stability characteristics of cB crystallin and most of the surface characteristics of bB2 crystallin In addition, this new protein,...

Ngày tải lên: 23/03/2014, 04:21

... for part -of- speech tagging In Proc Conf on Empirical Methods in Natural Language Processing, pages 133–142, Univ of Pennsylvania, PA Adwait Ratnaparkhi 1999 Learning to parse natural language ... criteria the neural networks are trained to optimize Two of the neural networks are trained using the standard maximum likelihood approach of optimizing the same probability which they ar...

Ngày tải lên: 23/03/2014, 19:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 18/06/2014, 18:20

... Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury Journal of NeuroEngineering and Rehabilitation ... Access Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomi...

Ngày tải lên: 19/06/2014, 08:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 20/06/2014, 01:20

... vehicle CAN bus As the first tests performed by the industrial car part supplier FAURECIA demonstrated that a static tuning is ineffective against road image variability, an automatic and adaptive tuning ... illustrate our approach for IPC tuning on a road image processing chain This application will also help us to introduce practical details of the methodology Natura...

Ngày tải lên: 22/06/2014, 23:20

... al.: Assessing the efficacy of a modified assertive community-based treatment programme in a developing country BMC Psychiatry 2010 10:73 Submit your next manuscript to BioMed Central and take ... occupational therapy assessments and coordination of medication issuing One major disadvantage of the teams’ location was the historical, custodial reputation of...

Ngày tải lên: 11/08/2014, 16:22

... universally applicable [43] Gene optimisation has shown promise for a number of infectious diseases For example, ad-based malaria vaccines have been developed containing malarial antigens optimised ... adaptation, optimal for mammalian expression One measure of codon quality is the Codon Adaptation Index (CAI), a measurement for the relative adaptiveness of the codon usa...

Ngày tải lên: 12/08/2014, 04:21

... universally applicable [43] Gene optimisation has shown promise for a number of infectious diseases For example, ad-based malaria vaccines have been developed containing malarial antigens optimised ... adaptation, optimal for mammalian expression One measure of codon quality is the Codon Adaptation Index (CAI), a measurement for the relative adaptiveness of the codon usa...

Ngày tải lên: 12/08/2014, 04:22

... difference in cardiac output as a function of mean cardiac output Mean difference in cardiac output, measured by arterial pressure-based carmean cardiac output diac output (APCO) and intermittent ... accurately assess cardiac output during changing of the vascular tone [6,7] A new arterial pressure-based cardiac output (APCO) device uses access to the...

Ngày tải lên: 13/08/2014, 08:20

... the alginate-encapsulate tumor cell assay Angiogenesis in alginate implants was quantified by measuring the uptake of FITC-dextran into the beads Vascularization of alginate beads was apparently ... delivered by an attenuated strain of Salmonella typhimurium[29] Plasmid DNA vaccines are attractive because they are relatively easy to engineer and produce, and are safe to administer t...

Ngày tải lên: 14/08/2014, 19:22

... to as dynamic orthogonal structure adaptation (DOSA) algorithm The algorithm can achieve compact network structure by employing a small number of parameters It takes advantage of a sliding data ... constructed by DOSA algorithm can react to the change of ship dynamics adaptively On- Line Tuning of a Neural PID Controller 1103 Conclusion With regard to the proble...

Ngày tải lên: 07/03/2015, 04:36

... DEVELOPMENT OF A GRAPHIC USER INTERFACE BASED ON OPENGL FOR A DROP -ON- DEMAND MICRO/ BIO FABRICATION SYSTEM CHEN JUEXUAN (Ms.) (B.Eng.), HUST A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... additional functions for the GUI, simulation and monitoring based on OpenGL As a common graphic interface developed by SGI [23], Open...

Ngày tải lên: 04/10/2015, 15:46