characterisation of the acto-myoa motor complex in toxoplasma gondii

... Fitz- gerald MC & Hendrickson WA (2007) Structural and thermodynamic characterization of a cytoplasmic dynein light chain intermediate chain complex. Proc Natl Acad Sci USA 104, 10028–10033. 16 Hall ... and mediates DNA damage-induced p53 nuclear accumulation. J Biol Chem 280, 8172–8179. 11 Navarro C, Puthalakath H, Adams JM, Strasser A & Lehmann R (2004) Egalitarian...

Ngày tải lên: 14/03/2014, 22:20

... FEBS Crystal structure of the parasite inhibitor chagasin in complex with papain allows identification of structural requirements for broad reactivity and specificity determinants for target proteases Izabela ... cystatin B N-terminus). (B) Zoom -in view of the interactions of papain with loop L6 of chagasin and loop L2 of cy...

Ngày tải lên: 16/03/2014, 04:20

... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAA...

Ngày tải lên: 23/03/2014, 04:20

... despite the close prox- imity of the tyrosines to the Q o binding site. Most of the mutants studied here alter the spectral features of the quinone, indicating a variation of the hydrogen- bonding ... bc 1 complexes from other organisms. The mutated residues are highlighted in Fig. 1. Results Site- directed mutations in the Q o binding site Mutatio...

Ngày tải lên: 23/03/2014, 10:20

... its role in mRNA degradation, the degradosome is also responsible for the processing of 5S ribosomal RNA and tRNAs, as well as the degradation of tmRNAs [4–8]. The principal proteins comprising the degradosome include ... microdomains in the C-terminal half of Vibrio angustum S14 RNase E, and have shown through two-hybrid analy- sis that the PNPase and enol...

Ngày tải lên: 29/03/2014, 21:20

... 2003 Thermodynamics of protein complex assembly (Eur. J. Biochem. 270) 4493 Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of ... Perham, R.N. (2002) Thermodynamic analysis of the binding of component enzymes in the assembly of the pyruvate dehydrogenase multienz...

Ngày tải lên: 30/03/2014, 20:20

... between the RC and the cyt bc 1 in the presence of mutated PufX protein The role of the PufX protein in facilitating the ubiquinone/ ubiquinol exchange between the Q B site of the RC and the ubiquinone ... important role in the structure of the core complex [12], we decided to investigate the possible structural role of the N-t...

Ngày tải lên: 31/03/2014, 09:20

... this article as: Sun et al.: Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke. Journal of Translational ... Tracking of BrdU-labeled neural stem cells at passage six in the ischemic brain of rat having undergone cell therapy for...

Ngày tải lên: 18/06/2014, 16:20

... purposes) Journal of Orthopaedic Surgery and Research Open Access Research article Function of anterior talofibular and calcaneofibular ligaments during in-vivo motion of the ankle joint complex Richard ... the position of the AJC was reproduced in the modeling soft- ware, the length of the ATFL and CFL was measured for each testing position o...

Ngày tải lên: 20/06/2014, 01:20

... MIRP induction, and IL-10 plays a major suppressive role in cartilage inflammation of the respiratory tract. Keywords: IL-10, matrilin-1, matrilin-1-induced relapsing polychondritis, major histocompatibility ... reported on the role of cytokines in RP, either in patients or in the corresponding animal models. In the CIA model, several cytokines have b...

Ngày tải lên: 09/08/2014, 01:24

... 13-acetate)/ionomycin activated T cells. (a) We detected interferon (IFN)-γ staining but no interleukin (IL)-4 staining. Mul- tiplex cytokine assay was used to analyse the cytokine profile of three ... (CI)-responsive T-cell linesTh1 polarisation of type I collagen (CI)-responsive T-cell lines. Cytokine expression of T-cell lines was determined by intracellular (IC) staining...

Ngày tải lên: 09/08/2014, 08:22

... simply reflect the level of synthesis/release and catabolism of endocannabinoids and entourage compounds in the synovium. The source of the endocannabinoids present in the synovium and synovial fluid ... Representative micrographs of this grading system are presented in Figure 1. Quantification of inflammatory cytokines in synovial fluid Cytokine pr...

Ngày tải lên: 09/08/2014, 10:23

... lactation. In conclusion our results show that the repeat breeding syndrome is a multifactorial problem involving a number of extrinsic factors as well as intrinsic factors coupled to the individual ... re- flected in the present study showing that ani- mals getting their first insemination during Jan- uary have higher risk of becoming RB animals. In agreement with our find...

Ngày tải lên: 12/08/2014, 15:20

... 0.01, and ***P < 0.001. Genetic and morphological characterisation of the Ankole cattle 471 Original article Genetic and morphological characterisation of the Ankole Longhorn cattle in the African ... disease and other stresses in improvement of ruminant livestock in the tropics, in: Proceedings of the 5th Genetic and morpholog...

Ngày tải lên: 14/08/2014, 13:21

... referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Characterisation of the Acto-MyoA motor complex ... Myosin A motor complex. This complex consists of the myosin heavy chain A (MyoA), the myosin light chain 1 (MLC1), the essential light chain 1 (ELC1) and three...

Ngày tải lên: 22/12/2014, 19:37