synthesis of carbon nanotubes and polymers to increase the performance of polymer blends
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3Â); GLU T46 2A forward (5Â- GAACAACTT AACAGATATGCCGGTTATT CCACCGGT GCC-3Â), GLU T46 2A reverse (5Â- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3Â); GLU H44 7A, ... Authors Journal compilation ê 2006 FEBS 2171 Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding s...
Ngày tải lên: 07/03/2014, 12:20
Surfing the waves of globalization - Asia and financial lobalization in the context of the trilemma
... HỌC KINH TẾ TP HCM KHOA SAU ĐẠI HỌC TIỂU LUẬN TÀI CHÍNH QUỐC TẾ ĐỀ TÀI: SURFING THE WAVES OF GLOBALIZATION: ASIA AND FINANCIAL LOBALIZATION IN THE CONTEXT OF THE TRILEMMA ... đặc sắc nhất được minh chứng bằng kinh nghiệm của các nền kinh tế euro. Mặt khác, nền kinh tế thị trường mới nổi xuất hiện hội tụ theo hướng giữa cái hiện đang áp dụn...
Ngày tải lên: 15/03/2014, 11:21
báo cáo hóa học:" The influence of the level of physical activity and human development in the quality of life in survivors of stroke" potx
... article as: Aidar et al.: The influence of the level of physical activity and human development in the quality of life in survivors of stroke. Health and Quality of Life Outcomes 2011 9:89. Submit ... differences in physical activity level and in the quality of life of stroke survivors in two cities differing in economi...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo toán học: "The role of multidisciplinary research and collaboration for improving the resilience of communities to volcanic risk" pot
Ngày tải lên: 20/06/2014, 21:20
Báo cáo lâm nghiệp: "Study of the properties of thirteen tropical wood species to improve the prediction of cutting forces in mode B" pptx
... to estimate cutting forces during wood machining, a factor remains difficult to take into consideration: the influence of wood species. Therefore, the aim of this study is to understand the influence ... estimating cutting forces involved during machining, particularly with difficulties in taking the influence of wood species into account accurately (wit...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo y học: "How possible is the development of an operational psychometric method to assess the presence of the 5-HTTLPR s allele? Equivocal preliminary findings" pdf
... this article as: Gonda et al.: How possible is the development of an operational psychometric method to assess the presence of the 5- HTTLPR s allele? Equivocal preliminary findings. Annals of ... (D), Discriminant Function Analysis, creation of scales on the basis of the above and then item analysis and calculation of sensitivity and specific...
Ngày tải lên: 08/08/2014, 23:21
báo cáo khoa học: " A randomized trial to assess the impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol" doc
... impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol [NCT00175240] Finlay A McAlister* 1,2 , ... Medicine, University of Calgary, Calgary, Canada, 4 The Royal Alexandra Hospital, Edmonton, Canada and 5 The University of...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... 7:25 http://www.virologyj.com/content/7/1/25 Page 4 of 7 RESEARC H Open Access Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes Huimin ... 129:283-290. doi:10.1186/1743-422X-7-25 Cite this article as: Xu et al.: Genomic variability in Potato virus M...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The trauma of ongoing conflict and displacement in Chechnya: quantitative assessment of living conditions, and psychosocial and general health status among war displaced in Chechnya and Ingushetia" pptx
... purposes) Conflict and Health Open Access Research The trauma of ongoing conflict and displacement in Chechnya: quantitative assessment of living conditions, and psychosocial and general health status ... the beginning of 2004 MSF undertook quantitative surveys among the displaced populations in Chechnya and neighbouring Ingushetia. M...
Ngày tải lên: 13/08/2014, 13:21
Báo cáo y học: "Assessing the effects of multiple infections and long latency in the dynamics of tuberculosis" ppt
... article as: Yang and Raimundo: Assessing the effects of multiple infections and long latency in the dynamics of tuberculosis. Theoretical Biology and Medical Modelling 2010 7:41. Submit your next ... TB. Our intention is to assess the effects of varying the model’s parameters in the back- ward bifurcation. We analyze the system (2) in steady states....
Ngày tải lên: 13/08/2014, 16:20
TIỂU LUẬN TÀI CHÍNH QUỐC TẾ ĐỀ TÀI: SURFING THE WAVES OF GLOBALIZATION: ASIA AND FINANCIAL LOBALIZATION IN THE CONTEXT OF THE TRILEMMA
... định hướng chính sách giữa các nền kinh tế, thì nó vẫn thất bại để xác định những động lực của các nền kinh tế cho những thay đổi chính sách. Vì thế, chúng Nhóm 6 – Tài chính quốc tế Trang 10/28 tôi ... câu hỏi cho nền kiến trúc tài chính quốc tế hiện tại cũng như các chính sách kinh tế vĩ mô riêng lẻ – vấn đề này được chú trọng trong một loạt những cuộc họp G20 t...
Ngày tải lên: 08/11/2014, 11:22
synthesis of carbon nanotubes and polymers to increase the performance of polymer blends
Ngày tải lên: 14/11/2014, 12:32
the role of ikkalpha, ikkbeta and nf-kappab in the progression of breast cancer
... Glasgow Theses Service http://theses.gla.ac.uk/ theses@gla.ac.uk Bennett, Lindsay (2014) The role of IKKalpha, IKKbeta and NF-kappaB in the progression of breast cancer. PhD thesis. ... The role of IKKalpha, IKKbeta and NF-kappaB in the progression of breast cancer Lindsay Bennett BSc(Hons), MSc Submitted in...
Ngày tải lên: 22/12/2014, 21:49