the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the ... Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx
... seekers in the planning and delivery of mental health service provision in London. A research audit on mental health needs and mental health provision for refugees and asylum seekers ... contributing factors to the long-term mental health of refugees and asylum seekers. The fundamental challenges faced by service provider...
Ngày tải lên: 24/02/2014, 18:20
Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx
... timescale in both of the free modules. Thus, these loops are strong candidates for binding sites of other complement and ⁄ or regulatory proteins. The large insertion between E and F strands in C1r ... protein module of C1r (CCP1 single ) and second complement control protein module of C1r (CCP2 single ) for the single CCP mod- ules, and CCP1 CCP2 and...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx
... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatosis and metastases in ... significance of stathmin expression in correlation with metastasis and clinicopathological characteristics in human ovarian carcinoma. Acta Histochemica 2008, 110:59-65. 37....
Ngày tải lên: 20/06/2014, 07:20
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach. Environmental Sciences ... Kraft (Duisburg, Germany) and J.T. Baker (Deventer, The Netherlands). For chemical analysis, standard stock solutions of the analytes an...
Ngày tải lên: 20/06/2014, 20:20
báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf
... investigated PAH compounds. System con- trol and data evaluation were done on a GC/MSD ChemStation (Agilent, Waldbronn, Germany). The determination of the pharmaceuticals (diclofenac and carbamazepine) ... fractions 1, 3, and 4 was probably caused by organic contaminants in additional precipitation runoff as well as in domestic sewage as it cannot be derived as a fun...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx
... (f) An area of an OA synovium demonstrates a lining layer completely devoid of c19orf10 staining. (g) Intense staining of a hyperplastic RA synovial lin- ing cell layer. This staining was typical ... Expression of c19orf10 in OA synovium. (a) Intense staining of the synovial lining layer and perivascular regions of RA (OCT sec- tion) tissue.(b) Intense staining of t...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo sinh học: "Cytogenetic and molecular characterization of eight new reciprocal translocations in the pig species. Estimation of their incidence in French populations" pot
... 389406 389 â INRA, EDP Sciences, 2002 DOI: 10.1051/gse:2002014 Original article Cytogenetic and molecular characterization of eight new reciprocal translocations in the pig species. Estimation of their incidence ... systematically and allows the detection of rearrangements modifying very slightly the size and/ or the banding profiles of the chromo...
Ngày tải lên: 14/08/2014, 13:21
IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY
... IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY Sarah C. Shuck Submitted to the faculty of the ... 34 2. Small Molecule Inhibition of RPA and its Effect on DNA Replication and Repair 2.1. Introduction The identification of small molecule...
Ngày tải lên: 24/08/2014, 11:28
design, synthesis, and characterization of polymeric materials for uses in energy storage applications
... Graduate School Department of Chemistry DESIGN, SYNTHESIS, AND CHARACTERIZATION OF POLYMERIC MATERIALS FOR USES IN ENERGY STORAGE APPLICATIONS A Thesis in Chemistry by Daniel ... numbers of other synthetic polymers were developed and commercialized in response to the growing need for new materials in the automotive and aerospace ind...
Ngày tải lên: 13/11/2014, 11:13
the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae
Ngày tải lên: 14/11/2014, 06:20
the identification and characterization of genes with potential roles in fetal ovary development
Ngày tải lên: 14/11/2014, 13:05
MODEL AND SOLUTION OF MUNICIPAL SOLID WASTE MANAGEMENT IN THE PERI-URBAN AREAS OF HA NOI INNER-CITY THROUGH 2030
... areas of Hanoi inner-city. - Building a model and solution of MSW management of in the peri-urban areas of Hanoi inner-city relevant to the planning of solid waste management of Hanoi through 2030. ... (430,15 ha) . 2.4. The forecast amount of generated MSW in the peri-urban areas of Hanoi through 2030 By 2030, the populati...
Ngày tải lên: 20/06/2015, 09:02