partnering in construction the views and experiences of poreign and local participants in vietnamese market

... provision of portal -of- entry primary care as well as secondary specialty care. They noted that diagnostic uncertainty, complexity, and discriminant variability are characteristic of chest pain assessment ... investigators were also present during the focus group. Data management and analysis Focus Group Qualitative Analyses The focus group was audiotaped and tran...

Ngày tải lên: 25/10/2012, 10:06

... experiences of health care and their views about the health care setting. They show how important is the child-friendly nature of the health care setting to children across Council of Europe member States ... Child-friendly health care: the views and experiences of children and young people in Council of Europe member Sta...

Ngày tải lên: 17/03/2014, 17:20

... mental health. The World Health Organisation states that health is a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity and mental health ... validation of a culturally relevant scale in a multi-ethnic asian population Janhavi Ajit Vaingankar 1*† , Mythily Subramaniam 1† , Siow Ann Chong...

Ngày tải lên: 20/06/2014, 15:20

... (2004), / 5 (1), 59–62 Effect of ultraviolet radiation on the hatchability and survival of eggs and larvae of sheep nematode Ademola Isaiah Oluwafemi* and Ademola Janet Ayobami 1 Department of Veterinary ... of change in UV radiation intensities base on length of exposure on the hatching of nematode eggs as well as the survival rate of...

Ngày tải lên: 07/08/2014, 17:22

... mountain species [31]. As for 426 F. Anthelme et al. F. Anthelme et al.Reproduction strategies of Alnus viridis Original article Secondary succession of Alnus viridis (Chaix) DC. in Vanoise National ... explanation of: – the respective roles of sexual and vegetative reproduc - tion strategies in explaining the colonization and per - sistence of A. v...

Ngày tải lên: 08/08/2014, 14:21

... inflam- matory process [8,9]. The dichotomy between the high adeno- sine levels in the inflamed tissues and the inability of adenosine to hamper the inflammatory process is explained by the increased ... 1 of 9 (page number not for citation purposes) Vol 8 No 1 Research article The PI3K–NF-κB signal transduction pathway is involved in mediating the ant...

Ngày tải lên: 09/08/2014, 07:20

... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgt...

Ngày tải lên: 10/08/2014, 10:21

... phosphorylation of pRb and expression of cyclin D1 in T98G, U87-MG and SW1783 glioma cell lines transfected with CDKN2A (A). However, knockdown of CDKN2A increased the phosphorylation of pRb and cyclin D1 in ... frequently inactivated in GBM. The CDKN2A acts as a cyclin- dependent kinase inbibitor, inbibiti ng the binding of the CDK4 protein to cylclin D...

Ngày tải lên: 10/08/2014, 10:21

... this article as: Tanamas et al., The association between subchondral bone cysts and tibial cartilage volume and risk of joint replacement in peo- ple with knee osteoarthritis: a longitudinal study ... Yuanyuan Wang 1 and Flavia M Cicuttini* 1 Abstract Introduction: To examine the natural history of subchondral bone cysts and to determine w...

Ngày tải lên: 12/08/2014, 12:20

... Japan and 5 Department of Respiratory and Allergic Medicine, Tosei General Hospital, Aichi, Japan Email: Fumi Hirayama - F.Hirayama@curtin.edu.au; Andy H Lee* - Andy.Lee@curtin.edu.au; Colin ... University of Technology, Perth, WA, Australia, 2 Department of Respiratory Medicine and Allergy, Komaki City Hospital, Aichi, Japan, 3 Department of Respiratory Medicine and...

Ngày tải lên: 12/08/2014, 14:20

... 52:48 http://www.actavetscand.com/content/52/1/48 Page 9 of 10 RESEARC H Open Access Pyelonephritis in slaughter pigs and sows: Morphological characterization and aspects of pathogenesis and aetiology Louise K Isling 1* , ... purpose of the present study was to describe the morphology, investigate the pathogenesis, and evaluate the aetiological role of E. c...

Ngày tải lên: 12/08/2014, 18:22

... ISAT dataset. Sensitivity analysis The impact of varying the number of admissions each patient incurred during the first year after the haemor- rhage extracted from the ISAT study and its impact in the LYs and QALYs ... beginning of each interval was calculated by subtracting from the number of people in the previous interval the number of deaths occurring...

Ngày tải lên: 13/08/2014, 11:22

... by macrophages and other cell types [99,100]. Therefore, one of the functions of MAP kinase signaling pathway may be to regulate the levels of cytokines or interleukines, thereby controlling cell mitosis in ... Access Review Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clini...

Ngày tải lên: 13/08/2014, 13:20

... to all data and take responsibility for the integrity of data and accuracy of data analysis. All authors contributed to analysis and interpretation of data, and to drafting of the manuscript and ... care units: overview of the Improving Medicine Through Pathway Assessment of Critical Therapy in Hospital-Acquired Pneumonia (IMPACT-HAP)...

Ngày tải lên: 14/08/2014, 07:21

... Thesis for the Degree of Doctor of Philosophy Partnering in Construction: The Views and Experiences of Foreign and Local Participants in Vietnamese Market ... Construction: The Views and Experiences of Foreign and Local Participants in Vietnamese Market Le Hoai Long Interdisciplinary Program of Construction Engine...

Ngày tải lên: 13/11/2014, 06:08