... GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGT...
Ngày tải lên: 18/02/2014, 13:20
... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf
... yard has remained a stable customer for Rudy. Many small and medium V. Finding Customers 33 A Marketing Guide for Small and Medium Sized Primary Forest Products Processors Mailing lists and ... and storage 12 II. Fundamentals of Marketing . Available at http://owic. A Marketing Guide for Small and Medium Sized Primary Forest...
Ngày tải lên: 18/02/2014, 22:20
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
... distribu- tion and require supervised /semi-supervised infor- mation for learning. We propose a flexible genera- tive model for transliteration mining usable for both unsupervised and semi-supervised ... super- vised and semi-supervised systems we mentioned, our model can be used for both unsupervised and semi-supervised mining in a consistent way. 3 Unsupervi...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf
... Association for Computational Linguistics, pages 16–19, Avignon, France, April 23 - 27 2012. c 2012 Association for Computational Linguistics TransAhead: A Writing Assistant for CAT and CALL ... potentials in CAT and CALL (significant boost in translation quality is observed). 1. Introduction More and more language learners use the MT systems on the Web for langu...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu A Science Roadmap for Food and Agriculture pdf
... p A Science Roadmap for Food and Agriculture 2 p A Science Roadmap for Food and Agriculture 16 p A Science Roadmap for Food and Agriculture Grand Challenge 1 hollowing-out will continue, and ... related to agricultural runo 36 p A Science Roadmap for Food and Agriculture Grand Challenge 3 4 p A Science Roadmap for Food and...
Ngày tải lên: 22/02/2014, 05:20
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx
... 52(2): 455-472. -311 - A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION Allan t~ amsay Department of Computer Science, University College Dublin, Belfield, DUBLIN 4, Ireland ABSTRACT It seems ... linguistic knowledge for both analysis and generation. We argue that the only part of the average NL system's knowledge that we can have any faith in is its vocabulary...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous expression of the P450scc system; they also amplify and extend recent information on an active P450scc ... 353 4184 A. Slominski et al.(Eur. J. Biochem. 271) Ó FEBS 2004 A novel pathway for sequential transformation of 7-dehydrocholesterol and expression...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
... appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. A novel method for crystalline silicon solar cells with low contact resistance and antireflection ... in any medium, provided the original work is properly cited. A novel method for crystalline silicon solar cells with low contact resis...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
... Access TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization Kyohei Mizutani 1* , Toshio Ito 1 , Masanori Sugimoto 1 and Hiromichi Hashizume 2 Abstract We describe a fast and ... shown in Figure 4, TSaT-MUSIC can be extended to a 3D localization algorithm. We can estimate two angles, θ a and θ b ,andonetime delay τ c by using two s...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf
... 2011, Article ID 925165, 11 pages doi:10.1155/2011/925165 Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate Thomas Lagkas 1 and Periklis Chatzimisios 2 1 Department ... Communications and Networking 7 Since POLL packet total size is equal to 272 bits, DATA packet total size is equal to 10192 bits, S...
Ngày tải lên: 21/06/2014, 05:20
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx
... obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12]. We Gene-expression and network- based analysis reveals a novel role for hsa-mir-9 and drug control over ... MAPKAP kinases Tamoxifen ESR1 Signaling mediated by p38- alpha and p38- beta pathway Six out of the 69 drugs in The Cancer Genome Atlas (TCGA) clinic...
Ngày tải lên: 11/08/2014, 12:21
báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot
... Biology Open Access Methodology article A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs Klaas Bouwmeester and Francine Govers* Address: ... (Brassica oleracea var. gemmifera) and rutabaga (swedes) (Brassica napus var. napobrassica) [6,7]. P. brassicae is mostly associated with post-har...
Ngày tải lên: 12/08/2014, 03:21
a novel scheme for human-friendly and time-delays robust neuropredictive teleoperation
... time index as the local master variables. This way the “feel” of teleoperation is natural and human-friendly, since the variables are simultaneous, and also not altered by the algorithm, as in existing ... rehabilitation and secure a greater and sooner impact on the life of many impaired persons. However, an important drawback for such applications lays in that, although curren...
Ngày tải lên: 26/10/2014, 14:31
security patterns and a weighting scheme for mobile agents
Ngày tải lên: 14/11/2014, 07:24