... are associated with exactly one synchronous production in the source and target language, and alternative translation possibilities are expressed as alternative edges Edges are further annotated ... A hierarchical phrase-based translation grammar was extracted for the NIST MT03 Chinese-English translation using a suffix array rule extractor (Lopez, 2007) A non-terminal span limit of 15 was ... Proc ACL L Huang, K Knight, and A Joshi 2006 A syntax-directed translator with extended domain of locality In Proc of AMTA P Koehn, F J Och, and D Marcu 2003 Statistical phrasebased translation...
Ngày tải lên: 07/03/2014, 22:20
... produced to date to suggest that Ap 4A and Ap 3A should have antagonistic effects in vivo in prokaryotes as well as in eukaryotes Therefore, although Ap 4A may appear to act as an immediate modulator of ... trace contaminants in the Ap 4A stock, but no ADP or Ap 3A is produced (B) A catalysis mixture containing mM Ap 4A and mM ADP shows rapid loss of ADP and Ap 4A (fitting exponential decay curves), and concurrent ... steadystate conditions, initial rates of catalysis of Ap 4A formation may be calculated from H2 and H8 proton peak integrations, and used to determine the main kinetic steady-state parameters for...
Ngày tải lên: 30/03/2014, 10:20
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for reference ... legal/financial counsel as may be appropriate for any matters to which the legal/financial materials and information may pertain Web sites included in this manual are intended to provide current and accurate ... planning, site and systems security, IT, financial and operational audits for an international clientele He has contributed numerous articles to audit−related publications and has authored and...
Ngày tải lên: 18/01/2014, 06:20
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratasereactivating factor in ADP-bound and nucleotide-free forms ... respectively, and the a and b subunits of the reactivase are abbreviated as aR and bR, respectively, molar ratios of aD, bD, cD, aR and bR in bands i and vi were determined to be about : : : : and : : : ... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase J Bacteriol 186, 6845–6854 Baker JJ & Stadiman TC (1982) Amino...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
... tubular apparatus with sharp curves, and for coating newly-made glass apparatus with a layer of soot to prevent too rapid cooling, and its usually associated result—cracking Fig 12.—Glass blower's ... MICROSCOPICAL EXAMINATION OF BACTERIA AND OTHER MICRO-FUNGI 69 Apparatus and Reagents used in Ordinary Microscopical Examination, 69—Methods of Examination, 74 VI STAINING METHODS 90 Bacteria Stains, ... only at supplementing the usually scanty details of technique, and at instructing the student how to fit up and adapt apparatus for his daily work, and how to carry out thoroughly and systematically...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc
... reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser needs to find an interpretation that starts ... utterances, with no systematic allowance for speech repairs and editing terms Such a treatment cannot adequately deal with dialogs involving more than one human (as appear in machine translation ... over that term to allow utterances to be formed around it This metarule (and our other metarules) can be viewed declaratively as specifying allowable patterns of phrase breakage and interleaving...
Ngày tải lên: 20/02/2014, 19:20
Tài liệu Báo cáo khoa học: "A rich environment for experimentation unification grammars" potx
... Computational L i n g u i s t i c s and Formal Semantics Cambridge University Press (to appear in 1989) Kaplan R, J Maxwell and A Zaenen (1987) 'Functional Uncertainty' In CSLI M o n t h l y , J a ... on a more satisfactory generation component, as well as t o o l s such as b i / m u l t i - l i n g u a l lexical access and transfer specifically crafted for use in machine translation research ... research Substantial fragments of German and French d e v e l o p e d in ud are already operational Sag I a n d C Pollard (1987) Head-Driven Phrase Structure G r a m m a r : an I n f o r m a l S y...
Ngày tải lên: 22/02/2014, 10:20
A New Vision for Adolescent Sexual and Reproductive Health pot
... how adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and health care providers,...
Ngày tải lên: 05/03/2014, 17:20
The ‘global health’ education framework: a conceptual guide for monitoring, evaluation and practice doc
... and transborder determinants of health, health inequities and inequalities, global health organisations and governance, human rights, medical peace work, environmental threats and climate change ... determinants Towards ‘health for all’ **/+ Learning opportunities in ‘global health’ should adopt and impart the ethical and practical aspects of achieving ‘health for all’ To ensure that educational ... health All authors have read and approved the final manuscript Authors’ information KB (Doctoral candidate) studied medicine in Frankfurt (Germany) and Bangalore (India), undergoing a research...
Ngày tải lên: 05/03/2014, 22:21
CUPOLOGY. HOW TO BE ENTERTAINING. INTERESTING FACTS FOR BOTH YOUNG AND OLD. TOASTS -- GEMS. HOW TO TELL AGE. PUBLISHED docx
... man and woman Something of importance has taken place in your national life and in your financial position, as well as in political and church affairs See the crowing cock and the stork, a change ... CHAPTER III THE WOMAN'S ERA OF NATIONAL IMPORT AN UNUSUAL KALEIDOSCOPE HUSBAND AND WIFE As the symbols are in uniting conjunction, you may both remain to formulate ideas and to delineate You are ... make acquaintance with your higher self not be so selfish nor material Eight years of strange wanderings with indecision and betrayal by a false black hand, as shown you Several gravestones and...
Ngày tải lên: 06/03/2014, 12:21
SEXUAL ORIENTATION AND SCHOOL POLICY A Practical Guide for Teachers, Administrators, and Community Activists potx
... who helped raise me and helped make me the person I am today Many thanks to my grandparents, Ian Callum and Marjorie Aitkens Macgillivray and Kenneth Henry and Dorothy Grefe Ruf Thanks also to my ... the Creator And I believe the moral absolutes that his word presents [He quotes a passage from the Bible here and continues.] God created Adam and Eve and not Adam and Steve God ordains and supports ... Available Library of Congress Cataloging-in-Publication Data Macgillivray, Ian K 1967Sexual orientation and school policy : a practical guide for teachers, administrators, and community activists...
Ngày tải lên: 15/03/2014, 05:20
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... metrics and levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial ... e ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages ... Error Analysis and Proposed Solutions for the Catalan—Spanish Language Pair LREC, 45(2):181–208 Mark Fishel, Ondˇej Bojar, Daniel Zeman, and Jan Berka r 2011 Automatic Translation Error Analysis...
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc
... lexical database Kristina Toutanova and Mark Johnson 2008 A bayesian LDA-based model for semi-supervised part-of-speech tagging In nips08 Antal Van Den Bosch and Walter Daelemans 1999 Memory-based ... Erwin Marsi Antal van den Bosch and Abdelhadi Soudi 2007 Memory-based morphological analysis and partof-speech tagging of arabic In Abdelhadi Soudi, Antal van den Bosch, and Gunter Neumann, editors, ... The tags are main tags for the Multext-East languages and detailed tags for English 492 Language English English English English English English Bulgarian Bulgarian Bulgarian Bulgarian Bulgarian...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "A Test Environment for Natural Language Understanding Systems" potx
... demand the details of each type of data • Enable access to a variety of database query capabilities ETE stores all types of intermediate data as strings in the database and provides regular-expression ... contextual information for annotation Annotation is a problem because it still takes a human ETE offers flexible and easy access to the intermediate data within and across batch runs For instance, ... semantic analyses for quality analysis and future reference We have so far used corrective and grading annotations In corrective annotation, the analyst corrects a wrong analysis, for example, a...
Ngày tải lên: 17/03/2014, 07:20
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx
... service agencies and social programs On the other hand, feedback from front- line paid care workers and volunteers reflected that the linkage between hospitals and social welfare agencies was inadequate ... reciprocal interactions between the elderly and their social environment are likely to influence their adaptability, access to information, and motivation to seek help from others Formal and informal ... collaboration of formal and informal support network s In my view, a supportive social environment can be created for the chronically ill elderly through both formal and informal social support systems...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: "A Graphical Environment for Graph-Based NLP" pdf
... York, USA ACM Press Vladimir N Vapnik 1998 Statistical Learning Theory Wiley-Interscience Xiaojin Zhu and Zoubin Ghahramani 200 2a Learning from labeled and unlabeled data with label propagation ... features are shown as squares The LexRank and TUMBL demonstrations are provided as both an applet and an application The user is presented with a graphical visualization of the algorithm that was conveniently ... represented as a vector of features The main assumption made is that a pair of objects and will be classified the same way if the distance between them in some space is small (Zhu and Ghahramani, 200 2a) ...
Ngày tải lên: 31/03/2014, 01:20
unix administration a comprehensive sourcebook for effective systems and network management
... international standards shortly after their adoption by the IEEE Therefore, these standards are available in printed form from both IEEE and ISO, as well as from many national standards organizations ... significant efforts toward standardization There are several standards bodies, both formal and informal Each body has different rules for membership, voting, and clout From a system administration standpoint, ... environment Dr Levi has also appeared as an author or co-author in more than 60 published and presented articles and papers and has received several awards for excellence and achievement © 2002...
Ngày tải lên: 07/04/2014, 15:43
interference calculus a general framework for interference management and network utility optimization
... convex analysis and linear algebra A general willingness to carry out detailed mathematical analysis is, however, important The proofs and detailed calculations should help the reader in penetrating ... denition, for any >0 γ ∈ ∂S (2.41) is achievable, at least in an asymptotic sense That is, there exists a p >0 such that SIRk (p ) ≥ γk − for all k ∈ K A general characterization of achievability can ... = x means that inequality holds for at least one component • exp(y) and log(y) means component-wise exponential and logarithm, respectively Some often used variables and quantities are as follows...
Ngày tải lên: 29/05/2014, 16:52
the mit press processing a programming handbook for visual designers and artists sep 2007
... than lines of text It has generated enthusiasm from thousands of musicians and visual artists who use it as a base for creating audio and visual software The same way graphical user interfaces ... personal desire for escape or transformation Leon Hong created an elegant flying simulation in which the player floats above a body of water and moves toward a distant island Muskan Srivastava wrote ... software examples Each student maintains a web page containing all of their software and source code created for the class These pages provide a straightforward way to review performance and make...
Ngày tải lên: 11/06/2014, 16:34
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
Ngày tải lên: 18/06/2014, 22:20