Common errors in the use of the definite article The made by the students in grade 11 at Yen Lac high school

... outstanding from the study, including theories of classroom discipline, motivation and second language acquisition. The inter-relationship among these aspects are also discussed in the analysis part ... in a language classroom: When it comes to studying discipline and motivation as a whole, a question is often raised: What brings about discipline and...

Ngày tải lên: 07/09/2013, 13:06

... cleaning of all dairy apparatus that in any way comes in contact with the milk is one of the most fundamental and important problems in dairying. All such apparatus should be so constructed as ... possess the faculty of growing either as parasites or saprophytes, in which case they are known as facultative parasites or saprophytes. The great majority of bacteria...

Ngày tải lên: 16/02/2014, 22:20

... occur in the context of a DNase I sensitive chromatin region, or a region with active- type histone modifications. Transgenic mice with a 99 bp deletion (containing two Pit-1 binding sites) of the ... expression level of Ig-b mRNA. Presence of DHSs in the Ig-b locus in cells deleted in regions I IV DHSs in the Ig-b locus were examined by genomic S...

Ngày tải lên: 19/02/2014, 16:20

... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3Â); GLU T46 2A forward (5Â- GAACAACTT AACAGATATGCCGGTTATT CCACCGGT GCC-3Â), GLU T46 2A reverse (5Â- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3Â); GLU H44 7A, ... Authors Journal compilation ê 2006 FEBS 2171 Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding s...

Ngày tải lên: 07/03/2014, 12:20

... 2006 FEBS Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis Wolfgang ... effect of adding increasing activities of WT CPU and YQ CPU on the clot lysis time, clearly showing the importance of...

Ngày tải lên: 07/03/2014, 12:20

... increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin. However, one of the potential difficulties in interpreting ... phosphatidylinositol 3-kinase, p70, S6 kinase and glycogen synthase kinase-3 activity in L6 muscle cells: evidence for the involvement of the mammalian...

Ngày tải lên: 08/03/2014, 08:20

... within the C-terminal domain of Ure2p that interacts with Ssa1p. Because the C-termi- nal domain of Ure2p is tightly involved in the assembly of the prion into fibrils [25–28] and because Ssa1p sequesters ... His-Tagged Ssa1p (B). (A) A mixture of untreated Ure2p and Ssa1p (lane 1); Ure2p alone (lanes 2, 5, 8 and 11), Ssa1p alone (lanes 3,...

Ngày tải lên: 15/03/2014, 00:20

... repair the link break, the node broadcasts an RREQ for that destination. Otherwise, the node makes a list of unreachable destinations consisting of the unreachable neighbor and any additional ... Resta, and P. Santi, A statistical analysis of the long-run node spatial distribution in mobile ad hoc networks,” in Proceedings of the ACM International Workshop...

Ngày tải lên: 21/06/2014, 11:20

... to estimate cutting forces during wood machining, a factor remains difficult to take into consideration: the influence of wood species. Therefore, the aim of this study is to understand the influence ... estimating cutting forces involved during machining, particularly with difficulties in taking the influence of wood species into account accurately (wit...

Ngày tải lên: 08/08/2014, 01:22

... fire germination 447 Original article The influence of seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus Otilia Reyes * and Mercedes ... with the smallest seeds, and is the most sensitive to seed age and the effects of fire. Of the two species of pine studied,...

Ngày tải lên: 08/08/2014, 14:21

... impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol [NCT00175240] Finlay A McAlister* 1,2 , ... Medicine, University of Calgary, Calgary, Canada, 4 The Royal Alexandra Hospital, Edmonton, Canada and 5 The University of...

Ngày tải lên: 11/08/2014, 05:22

... their ease of use and accessibility to a nonstatistical audience outweigh potential disadvantages. Commentary The value of monitoring outcomes should be measured by the appropriateness of the response Timothy ... respond rapidly with suitable investigation and corrective strategies if necessary.’ The real allure of these methods is that we may be able to achi...

Ngày tải lên: 12/08/2014, 23:23

... Osteopathy Open Access Research The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors Lars Top Møller* 1 , Michael Hansen 2 and ... aspects thereof. In doing so, they did not describe any conditions or pro- files or any standard management programs. Rather, their respon...

Ngày tải lên: 13/08/2014, 14:20

Ngày tải lên: 06/10/2014, 16:22

Ngày tải lên: 06/10/2014, 16:32