Báo cáo sinh học: " In-vitro model systems to study Hepatitis C Virus" ppt
... mononuclear cells (PBMCs) and hepatocytes. But, hepatocytes are the target cells for HCV replication. Hepatoma cell line 7721 is susceptible to HCV by incubation of cells with HCV infected serum. HCV ... that three to four million people are infected with HCV every year. HCV causes acute and chronic hepatitis which can eventually lead to permanent liver damage and hepatocellular carci...
Ngày tải lên: 14/08/2014, 19:22
... reverse: GGCTGTGACCGTTCAGAAGT; GAPDH Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of ... life technologies, Carlsbad, CA) according to the manufacturer’sprotocol.TotalRNAwasextractedby using Trizol reagent (Invitrogen life technologies, Carls- bad, CA) according to the manufa...
Ngày tải lên: 18/06/2014, 22:20
... manufacturer's specifications. Clonal Frequency Analysis (CFA) For each cloned HVR1 PCR product, 20 colonies were picked directly into tubes for re-amplification of the sec- ond round PCR product. ... of Southern California, Los Angeles, CA, USA, 8 Liver-Biliary-Pancreatic Center and the General Clinical Research Center, University of Connecticut Health Center, Farmington, CT, USA, 9...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: "Mechanisms of resistance to acrolein in Drosophila melanogaster" ppt
... by countercurrent distribution. Proc. Natl. Acad. Sci. USA 58, 1112-1119 Comendador M.A., Sierra L.M. & Gonzalez M. (1989) Genetic architecture of tolerance to acrolein ... Insecticide resistance: genes and mechanisms. In: Genetic con- sequences of Man-made Change, Academic Press, New York, pp. 53-96 Young S.S.Y. (1970) Direct and associated ......
Ngày tải lên: 14/08/2014, 20:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... Pasteur, Paris, France). The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment was cleaved by the restriction enzymes Nde1 ... (1998) Transcripts of a chimeric cDNA clone of hepatitis C virus genotype 1b are infec- tious in vivo. Virology 244, 161–172. 22 Mottola G, Cardinali G, Ceccacci A, Trozzi C, Bartholomew L,...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx
... phylogenetic congruence of previously deposited partial sequences of HCV-1g with respect to our sequence. Conclusion: In light of this, we propose changing the current status of its subtype-specific designation ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cite...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx
... does not seem to affect the susceptibility of HCVcc to heat treatment. Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl ... 10152025303540 * 0 1 2 3 4 5 0246 Minutes Log 10 FFU/ml 8 65 C 60 C B 56 C Log 10 FFU/ml HCVcc in culture medium HCVcc in culture medium HCVcc in human serum 0 1 2 3 4 5 6 0102030 Min...
Ngày tải lên: 12/08/2014, 04:21
o cáo hóa học:" Glycyrrhizin as antiviral agent against Hepatitis C Virus" ppt
... (licorice root extract) has anti-inflammatory and antioxidant activities. GL inhibits CD4+ T-cell and tumor necrosis factor (TNF)-mediated cytotoxicity [16]. GL has a membrane stabilizing e ffect ... containing one molecule of glycyrretinic acid, with structural similarities to hydrocortisone, and two molecules of glucuronic acid [6,7]. It has been attributed to numerous pharmacologic eff...
Ngày tải lên: 20/06/2014, 04:20
báo cáo sinh học:" A model linking clinical workforce skill mix planning to health and health care dynamics" pot
... system. The clinical workforce The clinical workforce of our concern is comprised prin- cipally of: ▪ 'Doctors' - medical practitioners who have graduated from a medical school on the completion ... 'Clinical Care Microsystems'. Figure 4 Addition of clinical care microsystem agency. Masnick and McDonnell Human Resources for Health 2010, 8:11 http://www.human-resources-heal...
Ngày tải lên: 18/06/2014, 17:20