Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx

Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx

Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx

... A pCMV ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA GCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTC GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT TTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGA T7 ... sites and polyA site. B A MCS polyA pValac 3742 bp BglII NheI AflII KpnI BamHI SpeI EcoRI...
Ngày tải lên : 14/08/2014, 19:22
  • 7
  • 313
  • 0
Báo cáo sinh học: "A new, fast algorithm for detecting protein coevolution using maximum compatible cliques" pptx

Báo cáo sinh học: "A new, fast algorithm for detecting protein coevolution using maximum compatible cliques" pptx

... compare the accuracy and performance of MMMvII to those of the original MMM an evaluation data set comprised of pairs of distance matrices was compiled using the OMA d atabase [16]http://www.omabrowser. com. We ... Canada 2 Department of Medical Biophysics, University of Toronto, Toronto, Canada Full list of author information is available at the end of the article Rodionov et al. Algorithm...
Ngày tải lên : 12/08/2014, 17:20
  • 9
  • 325
  • 0
Báo cáo sinh học: "A gene frequency model for QTL mapping using Bayesian inference" doc

Báo cáo sinh học: "A gene frequency model for QTL mapping using Bayesian inference" doc

... }. 1 11 2 2 2 1 4 − − = ∏      (29) Rather than drawing samples from a proposal for π, we draw samples from a proposal distribution of x and the sampled x is transformed to π. The proposal for x was taken to be a multivariate ... QTLs, and in posterior mean of QTL. Due to the good performance of biallelic analysis and increased computational cost of multiallelic analysis, biall...
Ngày tải lên : 14/08/2014, 13:21
  • 12
  • 296
  • 0
Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt

Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt

... are archaeal PolI, archaeal DNA polymerase II (PolII), bacterial DNA polymerase III α sub- unit (DnaE) and bacteriophage DNA polymerase I. Among these, archaeal PolI belongs to the family B DNA polymerase. ... polymerases from the Archaea, Bacteria and Eukarya domainsFigure 3 Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains. The Mimivirus...
Ngày tải lên : 18/06/2014, 22:20
  • 7
  • 435
  • 0
Báo cáo sinh học: " A new view on dam lines in Polish Arabian horses based on mtDNA analysis" doc

Báo cáo sinh học: " A new view on dam lines in Polish Arabian horses based on mtDNA analysis" doc

... 10.1051/gse:2007025 Original article A new view on dam lines in Polish Arabian horses based o n mtDNA analysis Iwona G ˙  a , Anna W a ,BarbaraG b Renata P a , Jerzy S a a Department ... purchased in the Near East and admitted as purebred Arabian mares. 610 I. G a zewska et al. Table I. Dam lines in Arabian horses in Poland: founders and main branches of t...
Ngày tải lên : 14/08/2014, 13:22
  • 11
  • 271
  • 0
Báo cáo sinh học: "A new Robertsonian translocation in Blonde d’Aquitaine cattle, rob(4;10)" pot

Báo cáo sinh học: "A new Robertsonian translocation in Blonde d’Aquitaine cattle, rob(4;10)" pot

... prepared from one phenotypically normal Blonde d’Aquitaine cow carrying the new translocation (the proband), its mother and 3 half-sisters (1 maternal half-sister and 2 paternal ... and grown Original article A new Robertsonian translocation in Blonde d’Aquitaine cattle, rob(4;10) I Bahri-Darwich EP Cribiu 1 HM Berland R Darré 1 INRA, Laboratoire de...
Ngày tải lên : 14/08/2014, 19:22
  • 7
  • 338
  • 0
Báo cáo sinh học: "A new Robertsonian translocation, 8/23, in cattle" potx

Báo cáo sinh học: "A new Robertsonian translocation, 8/23, in cattle" potx

... Note A new Robertsonian translocation, 8/23, in cattle L Biltueva, S Sharshova, A Sharshov, T Ladygina P Borodin A Graphodatsky Institute of Cytology and Genetics, Siberian Branch ... 138- 142 MATERIALS AND METHODS Seven animals (3Q and 4d ) of Grey Ukrainian cattle, heterozygous for a Robert- sonian translocation, were studied. The information o...
Ngày tải lên : 14/08/2014, 19:22
  • 7
  • 241
  • 0
Báo cáo sinh học: " A new method aimed at using the dominance variance in closed breeding populations" pot

Báo cáo sinh học: " A new method aimed at using the dominance variance in closed breeding populations" pot

... behaves worse for additivity or partial recessivity but the advantage for complete recessivity is still
Ngày tải lên : 14/08/2014, 20:20
  • 12
  • 228
  • 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACG...
Ngày tải lên : 07/03/2014, 21:20
  • 11
  • 668
  • 0
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx

Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx

... tool. 3 Or ˘ asan et al. (2000) enhanced the preference-based anaphora resolution algorithms by using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the opti- mal combination ... be applied too often, because then GA will in fact change to random search. Our mutation operator includes a proba- bility (3%) that an arbitrary weight in a vector will...
Ngày tải lên : 07/03/2014, 22:20
  • 10
  • 598
  • 0

Xem thêm