Báo cáo sinh học: "Is gene therapy a good therapeutic approach for HIV-positive patients?" pot

... suicide genes was made popular as a potential approach for treat- ing cancer. As an anti-HIV strategy this method was tried in vitro as proof-of-concept in a study that used a retrovi- rus to transduce ... sequences to a target RNA. It pairs with the target RNA forming a double-stranded RNA structure that either blocks translation or becomes a target for degradation in the c...

Ngày tải lên: 14/08/2014, 19:22

... >>>// // AAAAAA P1 P2 AAA P1 AAA P1 AAA P2 100.3 http://jbiol.com/content/8/11/100 Ouellette and Papadopoulou: Journal of Biology 2009, 8:100 Within the mammalian bloodstream, trypanosomes grow as long ... PLoS Pathog 2009, 5:e1000565. 7. Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, Berriman M, Sisk E, Rajandream MA, Adlem E, Aert R, Anupama A, Apostolou Z, Attipoe P,...

Ngày tải lên: 06/08/2014, 19:21

... (TNF)α, CD-20, IL-1 and IL-6 and T-cell co-stimulating factors (CTLA-4). No targeted treat- ments are available, however, for degenerative rheumato- logical diseases such as low back pain (LBP) due ... Page 1 of 2 (page number not for citation purposes) Available online http://arthritis-research.com/content/9/6/110 Abstract IL-1 plays a key role in disc degeneration and could be a val...

Ngày tải lên: 09/08/2014, 10:21

... estimate myocardial velocities at the mitral annulus to obtain an impression of both systolic and diastolic myocardial motion. The spectral Doppler pattern is characterized by a systolic wave, an ... by an atrial contraction flow velocity wave. Reduced LV relaxation (present in patients with advanced age, ischaemic heart disease or arterial hypertension) will induce a reduction of the E w...

Ngày tải lên: 13/08/2014, 03:21

... inflammation and discuss the therapeutic potential of various strategies targeting IL-17 for asthma. Introduction Asthma is a common airway disorder that is character- ized by chronic airway inflammation, ... evidence for an interaction between PPARγ signaling and IL-17 expression in allergic airway inflammation. STAT3 is a transcriptional activator required for IL-17 responses....

Ngày tải lên: 12/08/2014, 11:22

... Since then, DNA-based vaccines have garnered attention for their potential as alternative treatments for various dis- eases [1]. For vaccinologists, the main advantages of this approach are the adjuvant ... vaccine is safe for clinical use and indicate that the use of a plasmid containing the Hsp65 gene is reliable for gene therapy purposes as well as for vaccination in...

Ngày tải lên: 14/08/2014, 19:22

... the causal pathways between pay satisfaction, job satisfaction, organizational commitment and turnover intent [7]. The overall conclusion was that nurses, who are satisfied with job and pay, are ... 15 on job satisfaction data at 6 and 18 months using principal component analysis with var- imax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Developme...

Ngày tải lên: 18/06/2014, 17:20

... in Drosophila and Caenorhabditis than in verte brates. Since that time, genome data have become available for a broader range of species, so to what extent does this generalization still hold? ... controversial issue that can now be addressed is the gene complement of Urbilateria. It is clear that this ancestor of all bilateral animals had a genome resembling that of a modern...

Ngày tải lên: 06/08/2014, 19:21

... GCTACGCGTTCAGCACTATCAGATCGGG AC756F GCTACGCGTCCTTCCTAGCCCCACCT AC698F GCCACGCGTATCTATTAGCCTCGTCCCAC AC486F GATACGCGTCAGCCCGCCACATCTCAG AC374F GATACGCGCATAGCCCAGCCCATCTC AC216F GATACGGCGAATTGGGAGGAAGCC AC169F ... CTGCTCTCTACGAAAGGCCGTGC ACSF CCCAACTCGCCGCCTACCTTCC ACSG TCGCCGCCTACCTTCCGGAGCGC RGHF ACCACAAGTCCATGCCATCAC 58 GAPDH RHGR TCCACCACCCTGTTGCTGTA RACLF TCTGGGAGGTGTCAACGAG 58 ACL RACLR G...

Ngày tải lên: 14/08/2014, 13:21

... bypass grafting (CABG) is a major clinical problem that lacks an effective and proven pharmacological intervention. Late vein graft failure occurs due to neointima formation and accelerated atherosclerosis. ... peptide-modified Ad vectors to improve transduction to human vein graft cells and tissue and has important implications for gene therapy for CABG. Text Long term patency rate...

Ngày tải lên: 14/08/2014, 19:22