Báo cáo sinh học: " Genetic analysis of a divergent selection for resistance to Rous sarcomas in chickens " pdf

... either. The genetic analysis of the selection using estimated breeding values from an animal model provides a more accurate estimate of response to selection since it takes into account all the numerous ... the chicken for the analysis of immunoresponsiveness [31] or resistance to spe- cific diseases [3]. Resistance to viral diseases are examples of traits for...

Ngày tải lên: 14/08/2014, 13:22

... survival rate (probability at a particular age of surviving to the next age, Px); mortality rate (probability at a particular age of dying before the next age, Qx = 1 — ... of Alberta ranch at Kinsella, located 150 km south-east of Edmonton, Alberta, Canada. Two main breeding populations were established in 1960, namely the...

Ngày tải lên: 09/08/2014, 18:21

... that can be found from genealogical analy- sis: AA6 and AA9 are considered as pure AA, whereas AA5 and AA10 can have ancestors from another origin, the proportion of Arab origin being higher for ... registered in 2005 Sample size c AA10 Anglo-Arab W France 282 50 (13) AA5 781 50 (11) AA6 244 50 (15) AA9 252 50 (11) APPAL Appaloosa W USA 84 29 AB Arab-Barb W Morocco 71 38 AR Arab W Franc...

Ngày tải lên: 14/08/2014, 13:21

... JL: Aggregate diversity: New approach com- bining within- and between-breed genetic diversity. Livest Prod Sci 2005, 95:247-254. 3. Caballero A, Toro MA: Analysis of genetic diversity for the management ... citation purposes) Table 1: Original and incorrect Table Three presented in Leroy et al. (2009) Breed code Nb of breeding animals in 2005 Pr. extinction Agregate diversi...

Ngày tải lên: 14/08/2014, 13:21

... DNA vaccines. We examined the use of a novel L. lactis vector as the plas- mid backbone in DNA vaccines. The main advantages of this vector and its production strain are avoidance of anti- biotic resistance ... Halpern MD: Immunological properties of bacterial DNA. Ann N Y Acad Sci 1995, 772:152-163. 19. Yamamoto S, Yamamoto T, Shimada S, Kuramoto E, Yano O, Kataoka T, Tokunaga...

Ngày tải lên: 14/08/2014, 19:22

... site Macrosialin (pAcGFP-MS) F-T ATTAATGACCAAATCTACAGGGAGAACCC VspI/Eco47III R- AGCGCTAGATGCTCAGACCAGCTA EMR-1 (pAcGFP-EMR) F-T CATATGGAATTCTTTGTTTAGGTCTGTATGC NdeI/Eco47III R-T AGCGCTTACTGTGGCAGTCATTCA Beta-5 ... macrophage/non-macrophage evaluation was the highest in macrosalin as an indicator of macrophage specificity. After 24 hours of analysis there was a decreas- ing trend in...

Ngày tải lên: 14/08/2014, 19:22

... for genetic analysis of dystocia and calf mortality. J Dairy Sci 72, 2633-2643 Weller JI, Misztal I, Gianola D (1988) Genetic analysis of dystocia and calf mortality in ... were to analyze twinning rate in the Israeli Holstein dairy population by linear and threshold models, and to clarify the mode of inheritance of twinning, and...

Ngày tải lên: 14/08/2014, 20:20

... per-capita rate of predation of the predator, d > 0 is the death rate of predator, c > 0 denotes the product of the per-capita rate of predation and the rate of conversing prey into predator. ... 100 1 1.5 2 2.5 3 3.5 4 4.5 5 Figure 1 Dynamical analysis of a biological resource management model with impulsive releasing and harvesting Jianjun Jiao ∗1 , Lansun Chen 2 and...

Ngày tải lên: 21/06/2014, 17:20

... class="bi x0 y0 w1 h1c" alt ="" Statistical analysis All records were analysed by an SAS univariate procedure to test normal distribu- tion, and some extreme and abnormal data ... Council of Agriculture-Taiwan Livestock Research Institute (Taiwan Provincial Department of Agri- culture and Forestry) (COA-TLRI) and the Institut national de la recher...

Ngày tải lên: 09/08/2014, 18:22

... India99 AF390623 A India99 AF390659 A India2001 AF390630 A India99 AF390626 A India99 AF390638 A India99 AF390636 A India99 AF390672 A India93 AF390640 A India99 AF390637 A India99 AF390641 A India88 AF390608 ... India01 AY687334 Asia1 India97 AY593800 Asia1 Leb83 AY593798 Asia1 Leb89 AY593799 Asia1 Leb4 AF390612 A India88 AF390652 A India97 AF390615 A India94 AF390...

Ngày tải lên: 18/06/2014, 18:20