spectrophotometric analysis of a prepared sample for toluene

Báo cáo sinh học: " Genetic analysis of a divergent selection for resistance to Rous sarcomas in chickens " pdf

Báo cáo sinh học: " Genetic analysis of a divergent selection for resistance to Rous sarcomas in chickens " pdf

... genetic variability of these traits and to create extreme phenotypes allowing the analysis of underlying mechanisms and the search for new genetic markers of disease resistance traits Such tools are ... respectively At this step, sires and 21 dams (hatched in 1982 and originating from males and females) and sires and 21 dams (hatched in 1982 and originating from males and females) were selected and assigned ... [29] using the PEDIG software [4] 70 M.-H Pinard-van der Laan et al Table I Number of animals measured, data recorded and Rfp-Y type analysed, per line and generation Line Year G1 P2 82 83 157...

Ngày tải lên: 14/08/2014, 13:22

17 296 0
A Meta-Analysis of Fear Appeals: Implications for Effective Public Health Campaigns pdf

A Meta-Analysis of Fear Appeals: Implications for Effective Public Health Campaigns pdf

... successes and failures of fear appeals, and fear is reincorporated as a central variable in the model According to the EPPM, the evaluation of a fear appeal initiates two appraisals of the message, which ... outcomes META -ANALYSIS Rationale Meta -analysis is a quantitative method that synthesizes the results of a particular group of studies Researchers gather all available studies on a topic and then ... level of either fear or threat in a message were retained for analysis To be included in this meta -analysis, fear appeal studies needed to manipulate fear or threat in a fear appeal message (i.e.,...

Ngày tải lên: 05/03/2014, 22:21

25 486 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure of ... Karplus PA (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography Nat Struct Biol 4, 269–275 Richter Dahlfors AA & Kurland CG (1990) Novel mutants of elongation ... conformation (C), and EF-G stability (D) Several mutations seem to affect more than one of these parameters; for example, EF-G conformation and stability are intimately linked to FA binding as...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot

... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) was ... intact panitumumab Trastuzumab F(ab’)2 was used as a negative control All values were corrected for on a nanomolar basis The immunoreactivity of the 111 In-panitumumab F(ab’)2 was assessed in a ... Figure SDS-PAGE analysis of panitumumab F(ab’)2 The panitumumab F(ab’)2 was evaluated by SDS-PAGE before (a) and after (b) the final step of buffer exchange and concentration using a Centriprep...

Ngày tải lên: 21/06/2014, 02:20

15 452 0
Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx

Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx

... two alternative architectures of the single-core and multicore approach Also, the details for the data analysis of the microarray of a custom Lab-on-Chip are described 4.1 Microarray data analysis ... PROCESSING ALGORITHM Statistical analysis of microarray data can essentially process massive amounts of data and can also adjust for various sources of variability in order to identify the important ... evaluate and design a scalable architecture to elaborate large volume of DNA microarray data, we used field-programmable gate array (FPGA) technology The first target of evaluation is the use of...

Ngày tải lên: 21/06/2014, 22:20

11 614 0
Tài liệu mẫu phân tích IPA  Importance   performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic

... s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions of service quality in tourism – an Indian perspective”, Total Quality Management, Vol 20, No ... destination attributes unique to Kerala like boat race, art, heritage and handicrafts have been included for assessing the destination attractiveness All Kerala specific tourist attractions and activities ... importance attached by tourists to various items in a destination and the performance of each item at the destination Based on the above literature this paper, applies the ImportancePerformance Analysis...

Ngày tải lên: 01/08/2014, 10:25

7 876 3
Báo cáo y học: " A meta-analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma" ppsx

Báo cáo y học: " A meta-analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma" ppsx

... meta -analysis was not based on individual patient data and was not subjected to an open externalevaluation procedure Therefore, the analysis is limited in that the use of published data may have ... Hu et al.: A meta -analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma Journal of Hematology & Oncology 2011 4:11 Submit your next manuscript ... S, Hinke A, Labianca R, Louvet C: Meta -analysis of randomized trials: evaluation of benefit from gemcitabine-based combination chemotherapy applied in advanced pancreatic cancer BMC Cancer 2008,...

Ngày tải lên: 10/08/2014, 21:23

15 380 0
báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

... opinion leaders : effects on professional practice and health care outcomes The Cochrane Database of Systematic Reviews 2005:4 Armenakis AA, Bedeian AG: Organizational change: a review of theory and ... Christian S: Achieving change in health care practice Journal of Evaluation in Clinical Practice 2003, 9:225-238 Armenakis A, Bedeian A: Organizational change: a review of theory and research in ... Qualitative data analysis for applied policy research In Analysing Qualitative Data Edited by: Bryman A and Burgess RG London, Routledge; 1994 Mays N, Pope C: Qualitative Research in Health Care...

Ngày tải lên: 11/08/2014, 05:22

11 319 0
báo cáo khoa học: " Analysis of a post-translational steroid induction system for GIGANTEA in Arabidopsis" pdf

báo cáo khoa học: " Analysis of a post-translational steroid induction system for GIGANTEA in Arabidopsis" pdf

... 5'-GAATTAGGGAACAGCCACGA-3' for CO, 5'-CTGGAACAACCTTTGGCA AT-3' and 5'-TACACTGTTTGCCTGCCAAG-3' for FT, 5'-CGAAAGCTTCCTCCTGGTTA-3' and 5'-GAGTTTTGCCCCTCACCATA-3' for SOC1, 5'-GATTCCACGAGTTTGGGAGA-3' ... 5'-GATTCCACGAGTTTGGGAGA-3' and 5'-CCTTAGCCATTGGGAGATCA-3' for TOC1, 5'-GCGTTGCCTCCTAATGGTAA-3' and 5'ACCCTCCAACTCCCTGTACC-3' for HAP 3A, 5'TGCTTTTTCATCGACACTGC-3' and 5'-CCATATGTGTCCGCAAAATG-3' for At2g32170, ... with a dilution series of an arbitrary cDNA sample The following primer pairs were used for qRT-PCR; 5'TTGCAACTCCAAGTGCTACG-3' and 5'-GCTCGAAGGAGTTCCACAAG-3' for GI, 5'-ACTGGTGGTGGATCAAGAGG-3' and...

Ngày tải lên: 12/08/2014, 03:21

13 245 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx

Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx

... complications, and linear regression analysis was used for length of stay Because of nonparametric distribution, length of stay data were logarithmically transformed before regression analysis Parameters ... group Author contributions TMV participated in the design of the study, data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript ... undergoing transhiatal or transthoracic esophagectomy for cancer Ann Surg 2003, 237:35-43 Katz MH: Multivariable analysis: a primer for readers of medical research Ann Intern Med 2003, 138:644-650 Van...

Ngày tải lên: 12/08/2014, 20:20

6 368 0
Báo cáo sinh học: "Analysis of a simulated microarray dataset: Comparison of methods for data normalisation and detection of differential expression (Open Access publication)" pps

Báo cáo sinh học: "Analysis of a simulated microarray dataset: Comparison of methods for data normalisation and detection of differential expression (Open Access publication)" pps

... ensured that the variance in M values was consistent across arrays Data normalisation of gene expression analysis 675 Table II Summary of the 12 methods used for analysing the simulated data Analysis ... to a simulated data set produced by the SIMAGE package [1] The data set is a simple comparison of two biological states on ten arrays, with dye-balance A number of data quality, normalisation and ... median log ratios and the range of log ratios across slides This data set was subject to a total of 12 different analysis methods, encompassing a variety of techniques for assessing data quality,...

Ngày tải lên: 14/08/2014, 13:22

15 265 0
presentation and analysis of a multi-dimensional interpolation function for non-uniform data microsphere projection

presentation and analysis of a multi-dimensional interpolation function for non-uniform data microsphere projection

... PRESENTATION AND ANALYSIS OF A MULTI-DIMENSIONAL INTERPOLATION FUNCTION FOR NON-UNIFORM DATA: MICROSPHERE PROJECTION William Dudziak Thesis Approved: Accepted: Advisor Yingcai Xiao Dean of the ... clustered data, interpolation error will vary as the distance to the nearest sample or cluster of samples The current predominant methods for interpolating non-uniform data are not guaranteed to handle ... interpolations are based on a set of sample points; these are points in space with known values Local interpolations are methods which make use of the information from only a small set of nearby sample...

Ngày tải lên: 30/10/2014, 20:12

157 326 0
CONVERGENCE ANALYSIS OF A PROXIMAL POINT ALGORITHM FOR MINIMIZING DIFFERENCES OF FUNCTIONS

CONVERGENCE ANALYSIS OF A PROXIMAL POINT ALGORITHM FOR MINIMIZING DIFFERENCES OF FUNCTIONS

... past three decades, Pham Dinh Tao, Le Thi Hoai An and many others have contributed to providing mathematical foundation for the algorithm and making it accessible for applications The (DCA) ... like to thank the VIASM for financial support and hospitality The research of the second author was partially supported by the USA National Science Foundation under grant DMS-1411817 and the Simons ... minimization of DC Functions, Journal of Computational Mathematics, 21, 451-462 (2003) 12 Moudafi, A. , Maing´e, P E.: On the convergence of an approximate proximal method for DC functions, Journal of...

Ngày tải lên: 12/10/2015, 16:21

23 319 0
Performance analysis of a random search algorithm for distributed autonomous mobile robots

Performance analysis of a random search algorithm for distributed autonomous mobile robots

... in a circular array, similar to the light and ultrasonic range sensor layer These IR transceivers are standard IrDa 1.0 compliant They are directional and allow communication via the IR channel ... general, there are two approaches: plan-based and random search Plan-based techniques require more capabilities of the robots, such as self-localization and better sensors, compared to random search ... back and look at nature for ideas The reason being that nature itself has lots of proven working examples of real life cooperative systems How does a wolf pack coordinate and organize the pack...

Ngày tải lên: 28/11/2015, 13:34

156 261 0
Parametric analysis of a circulating fluidized bed biomass gasifier for hydrogen production

Parametric analysis of a circulating fluidized bed biomass gasifier for hydrogen production

... study was validated against the experimental data of Keawpanha et al [29] using Japan cedar as a biomass The gasifier was operated at the temperature of 700  C, S/B of one and steam temperature of ... material, which can be either sand or char; in addition, these apparatuses recirculate nearly all of the bed material and char with a cyclone separator A schematic diagram of a CFB biomass gasifier ... Chutichai B, Authayanun S, Assabumrungrat S, Arpornwichanop A Performance analysis of an integrated biomass gasification and PEMFC (proton exchange membrane fuel cell) system: hydrogen and power...

Ngày tải lên: 29/07/2016, 14:03

8 416 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis of production costs sensitivity analysis was done ... 5,766,604 Table 15 Comparison in percentage values of calculated parameters in the scenarios Item ICC AARaverage Operating costaverage O&Maverage Debtaverage Taxaverage LRC Dv Source: own elaboration ... Climate Database and Retscreen Product Database for the characterization of the wind system, both available at the RETScreen Version Software for evaluation of projects in renewable energy The parameters...

Ngày tải lên: 05/09/2013, 14:59

14 416 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

... that, for H/D ratio 1.92, the maximum Cp obtained is 0.042 at a TSR of 0.747 and maximum Ct obtained is 0.055 at a TSR of 0.747 and the standard deviations of Cp and Ct are 0.38% and 0.53% (a) ... under the guidance of Prof Rajat Gupta His area of interest is in the field of fluid dynamics and its application, wind energy E-mail address: sukantamech07@gmail.com Agnimitra Biswas is a PhD student ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...

Ngày tải lên: 05/09/2013, 15:28

16 364 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all ... performance of each state is defined as the minimum capacity of each interval, that is: g1 = 5200 , g = 5550 , g3 = 5700 , g = 5850 , V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of ... ) are not considered Then we can get the state performance of the battery is From Fig we know that the results obtained by the traditional system reliability theory are always conservative For...

Ngày tải lên: 03/01/2014, 19:38

4 408 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...

Ngày tải lên: 12/02/2014, 10:20

9 497 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
w