Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

... and distances in cM are given on the x-axis, and F-ratios are indicated on the y-axis. 534 G. Yang et al. Original article Genome-wide identification of QTL for age at puberty in gilts using a ... regulating the maturation of the hypothalamic-pituitary-gonadal axis remain largely unknown. Thus, the identifi- cation of d eterminant factors of age at puberty...

Ngày tải lên: 14/08/2014, 13:21

... a characteristic set of mass peaks in the range of 5–10 kDa, typically including two dominating peaks at approximately m ⁄ z 7000. As mycelia and spores largely remained intact, and the extraction ... amounts) and requiring minimal sample preparation. Bacterial intact-cell MALDI-TOF spectra in the range 2–20 kDa are dominated by a set of ri- bosomal proteins as highly abundant...

Ngày tải lên: 19/02/2014, 02:20

... including both enantiomers of glutamate, asparagines, glutamine, alanine, serine, lysine, and arginine, were inactive as substrates. The enzyme was not inhibited by these nonsubstrate amino acids ... enzymatic aspartate racemiza- tion was measured against various concentrations of both enantiomers of the amino acid. As shown in T able 2, the K m AB Fig. 1. SDS/PAGE of aspartate race...

Ngày tải lên: 07/03/2014, 16:20

... theoretical justification for our binary classification. Section 3 also shows how to automatically extract and collect counts for context patterns, and how to combine the information using a machine learned classifier. ... incorporating linguistically moti- vated patterns. In ACL Workshop on Feature Engi- neering for Machine Learning in NLP, pages 40–47. Colin Cherry and Shane Berg...

Ngày tải lên: 08/03/2014, 01:20

... for identification of proteins. Selected signals in spectra were used for MS ⁄ MS fragmentation and search for matching peptides using the same database and search engine. Mass determination of ... bands, coinciding with the appearance of a significant deacyla- tion activity. Any bacterial contamination of our protein preparations that might be responsible for acti- vati...

Ngày tải lên: 16/03/2014, 04:20

... 5¢-ATGGAYATHGCIACIACICARGC-3¢;P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGG GIAAYGARGTIGAYATHG-3¢; ... 5¢-CTAGACC TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCG...

Ngày tải lên: 17/03/2014, 09:20

... bacteria, Candidatus ‘Scalindua brodae’ and ‘Scalindua wagneri’, identified in a wastewater treatment plant treating landfill leachate [8]. Anammox catabolism takes place in a separate membrane-bounded ... imperme- able ladderane membrane is thought to be able to gen- erate and maintain a proton motive force for ATP synthesis [26]. That planctomycetes not capable of anammox and no...

Ngày tải lên: 23/03/2014, 15:20

... Mutagenesis Kit was from Stratagene (La Jolla, CA, USA). Construction of plasmids A BamHI site (GAATTC) was created at a point before the starting Met codon of hIZA1 cDNA by site-directed muta- genesis. ... spectra revealed a 14 NO-bound penta-co-ordinated heme, indicating that the co-ordination between heme iron and an amino acid was disrupted upon binding of NO. hIZA1 and hI...

Ngày tải lên: 30/03/2014, 11:20

... Europarl: A parallel corpus for statistical machine translation. In Proceedings of the 10th Machine Translation Summit, Phuket, Thai- land, pages 79–86. Canasai Kruengkrai, Prapass Srichaivattana, ... geographical information of the users. Human annotations on 5000 automatically an- notated queries showed that our data generation method is highly accurate, achieving 84.3% accu- racy...

Ngày tải lên: 30/03/2014, 23:20

... algebraic ap- proach can provide fairly accurate initializations for CTALS, Blind Identification of Out -of- Cell Users in DS-CDMA 1217 Recall that ∗ stands for a nonzero entry; ¯ A ( ¯ S)isacolumn- reduced ... matrix of A (S). Invoking Lemma 1,wealways can pick a pair (µ 1 , µ 2 ) ∈ R 2 such that E :=  11 µ 1 µ 2  10∗ · · ∗ 01∗ · · ∗  =  11• · · • µ...

Ngày tải lên: 23/06/2014, 01:20