Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

Báo cáo sinh học: " Genome-wide identification of QTL for age at puberty in gilts using a large intercross F2 population between White Duroc · Erhualian" pdf

... and distances in cM are given on the x-axis, and F-ratios are indicated on the y-axis. 534 G. Yang et al. Original article Genome-wide identification of QTL for age at puberty in gilts using a ... regulating the maturation of the hypothalamic-pituitary-gonadal axis remain largely unknown. Thus, the identifi- cation of d eterminant factors of age at puberty...
Ngày tải lên : 14/08/2014, 13:21
  • 11
  • 185
  • 0
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx

Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx

... a characteristic set of mass peaks in the range of 5–10 kDa, typically including two dominating peaks at approximately m ⁄ z 7000. As mycelia and spores largely remained intact, and the extraction ... amounts) and requiring minimal sample preparation. Bacterial intact-cell MALDI-TOF spectra in the range 2–20 kDa are dominated by a set of ri- bosomal proteins as highly abundant...
Ngày tải lên : 19/02/2014, 02:20
  • 12
  • 632
  • 0
Báo cáo khoa học: Molecular identification of monomeric aspartate racemase from Bifidobacterium bifidum pptx

Báo cáo khoa học: Molecular identification of monomeric aspartate racemase from Bifidobacterium bifidum pptx

... including both enantiomers of glutamate, asparagines, glutamine, alanine, serine, lysine, and arginine, were inactive as substrates. The enzyme was not inhibited by these nonsubstrate amino acids ... enzymatic aspartate racemiza- tion was measured against various concentrations of both enantiomers of the amino acid. As shown in T able 2, the K m AB Fig. 1. SDS/PAGE of aspartate race...
Ngày tải lên : 07/03/2014, 16:20
  • 6
  • 347
  • 0
Báo cáo khoa học: "Distributional Identification of Non-Referential Pronouns" pdf

Báo cáo khoa học: "Distributional Identification of Non-Referential Pronouns" pdf

... theoretical justification for our binary classification. Section 3 also shows how to automatically extract and collect counts for context patterns, and how to combine the information using a machine learned classifier. ... incorporating linguistically moti- vated patterns. In ACL Workshop on Feature Engi- neering for Machine Learning in NLP, pages 40–47. Colin Cherry and Shane Berg...
Ngày tải lên : 08/03/2014, 01:20
  • 9
  • 351
  • 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

... for identification of proteins. Selected signals in spectra were used for MS ⁄ MS fragmentation and search for matching peptides using the same database and search engine. Mass determination of ... bands, coinciding with the appearance of a significant deacyla- tion activity. Any bacterial contamination of our protein preparations that might be responsible for acti- vati...
Ngày tải lên : 16/03/2014, 04:20
  • 12
  • 486
  • 0
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

... 5¢-ATGGAYATHGCIACIACICARGC-3¢;P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGG GIAAYGARGTIGAYATHG-3¢; ... 5¢-CTAGACC TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCG...
Ngày tải lên : 17/03/2014, 09:20
  • 16
  • 528
  • 0
Báo cáo khoa học: Structural identification of ladderane and other membrane lipids of planctomycetes capable of anaerobic ammonium oxidation (anammox) pptx

Báo cáo khoa học: Structural identification of ladderane and other membrane lipids of planctomycetes capable of anaerobic ammonium oxidation (anammox) pptx

... bacteria, Candidatus ‘Scalindua brodae’ and ‘Scalindua wagneri’, identified in a wastewater treatment plant treating landfill leachate [8]. Anammox catabolism takes place in a separate membrane-bounded ... imperme- able ladderane membrane is thought to be able to gen- erate and maintain a proton motive force for ATP synthesis [26]. That planctomycetes not capable of anammox and no...
Ngày tải lên : 23/03/2014, 15:20
  • 14
  • 421
  • 0
Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx

Báo cáo khoa học: Molecular identification of adrenal inner zone antigen as a heme-binding protein potx

... Mutagenesis Kit was from Stratagene (La Jolla, CA, USA). Construction of plasmids A BamHI site (GAATTC) was created at a point before the starting Met codon of hIZA1 cDNA by site-directed muta- genesis. ... spectra revealed a 14 NO-bound penta-co-ordinated heme, indicating that the co-ordination between heme iron and an amino acid was disrupted upon binding of NO. hIZA1 and hI...
Ngày tải lên : 30/03/2014, 11:20
  • 12
  • 351
  • 0
Báo cáo khoa học: "Language Identification of Search Engine Queries" pdf

Báo cáo khoa học: "Language Identification of Search Engine Queries" pdf

... Europarl: A parallel corpus for statistical machine translation. In Proceedings of the 10th Machine Translation Summit, Phuket, Thai- land, pages 79–86. Canasai Kruengkrai, Prapass Srichaivattana, ... geographical information of the users. Human annotations on 5000 automatically an- notated queries showed that our data generation method is highly accurate, achieving 84.3% accu- racy...
Ngày tải lên : 30/03/2014, 23:20
  • 9
  • 453
  • 0
Báo cáo hóa học: " Blind Identification of Out-of-Cell Users in DS-CDMA" potx

Báo cáo hóa học: " Blind Identification of Out-of-Cell Users in DS-CDMA" potx

... algebraic ap- proach can provide fairly accurate initializations for CTALS, Blind Identification of Out -of- Cell Users in DS-CDMA 1217 Recall that ∗ stands for a nonzero entry; ¯ A ( ¯ S)isacolumn- reduced ... matrix of A (S). Invoking Lemma 1,wealways can pick a pair (µ 1 , µ 2 ) ∈ R 2 such that E :=  11 µ 1 µ 2  10∗ · · ∗ 01∗ · · ∗  =  11• · · • µ...
Ngày tải lên : 23/06/2014, 01:20
  • 13
  • 197
  • 0

Xem thêm

Từ khóa: