Báo cáo y học: ":RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes" potx

... for bioin- formatics to provide a statistically valid interpretation of compound lists produced experimentally. Currently, several bioinformatics approaches are available for metabolomics. Each ... Yamada T, Kanehisa M & Bork P (2008) iPath: interactive exploration of biochemical pathways and networks. Trends Biochem Sci 33, 10 1–1 03. 33 Okuda S, Yamada T, Hamajima M,...

Ngày tải lên: 16/03/2014, 01:20

... illustrates that the target of anti-rheumatic treatment is moving in time. It is therefore an extra advantage to use a continuous measure with absolute values to measure disease activity in daily ... clinical practice and clinical trials. Conclusion The study of Vander Cruyssen and colleagues confirms that the DAS28 is a valid measure to monitor disease activity and to t...

Ngày tải lên: 09/08/2014, 07:20

... inadequate because substantial renal tissue damage can occur before function is impaired to a detectable extent [4]. Renal biopsy remains the gold standard for assessment of LN disease activity. ... injury has anti- inflammatory effects [5]. In the current paper by Schwartz and colleagues, TWEAK was assessed as a biomarker for LN in both cross-sectional and longitudinal studies. In...

Ngày tải lên: 09/08/2014, 14:22

... eight publicly available Neisseria genome sequences and stored all these data in a publicly accessible online database. The potential of NeMeSys for narrowing the gap between sequence and function ... sequenced and assembled strain 8013's genome. DV, AL and CM contributed and managed bioinfor- matics resources. DV and VP performed manual annotation and...

Ngày tải lên: 09/08/2014, 20:20

... apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19%. To systematically compare the miRTRAP and miRDeep methods, we tested the new Ciona library data using ... computational analysis. WS and DH analyzed the data. WS, DH and ML wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank Benj...

Ngày tải lên: 09/08/2014, 20:21

... framework for perform- ing computational analyses, systematically repeating ana- lyses, capturing all details of performed analyses, and annotating analyses. Using Galaxy Pages, researchers can communicate ... When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step. Galaxy’s metadata includes every piece of informa- tion necessary to...

Ngày tải lên: 09/08/2014, 20:22

... Access FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data Andrea Sboner 1,2† , Lukas Habegger 1† , Dorothee Pflueger 3 , Stephane Terry 3 , David ... of each pri- mer (forward, TMPRSS2 exon 1 - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon 5 - GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at...

Ngày tải lên: 09/08/2014, 22:23

... program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool. In this paper, we provide a general ... relevant clinical practice guidelines (Clinical Practice Guidelines). It also discusses the why, what and how of measuring baseline performance defined as the measurement...

Ngày tải lên: 11/08/2014, 05:22

... non -adherence to antide- pressant therapy is a problem in the manageme nt of depression in Thailand. Our study is an early step in establishing the MPR as a clinically useful way to esti- mate adherence ... and Immediate-Release Paroxetine. Journal of Clinical Psychopharmacology 2004, 24(5):544. 7. Wipisamakul S, Chulakadabba S, Charatchrungwitaya S, Wanachavee U: A Stud...

Ngày tải lên: 11/08/2014, 16:22

... Libeskind-Hadas 1* Abstract Background: This paper describes the theory and implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology ... graphical user interface but can be s et in the command-line version of Jane. Values of the se parameters were systematically evaluated and the best values found are us...

Ngày tải lên: 12/08/2014, 17:20

... data. This is the benchmark to compare it against a p value. The simplest relation between p values and Bayes factors are based on a Gaussian approximation. In that situation, the Bayes factor ... terms of age, gender, ethnicity, admitting diag- Figure 3 Artificial intelligence at the point-of -care in the ICUArtificial intelligence at the point-of -care in th...

Ngày tải lên: 13/08/2014, 11:23

... a research ELISA, is an early predictive biomarker of acute kidney injury (AKI) after cardiopulmonary bypass (CPB).  e availability of a standardized clinical platform for NGAL measurements ... is â 2010 BioMed Central Ltd NGAL: an emerging tool for predicting severity of AKI is easily detected by a clinical assay Wes Gabbard, 1 Eric B Milb...

Ngày tải lên: 13/08/2014, 20:22

... actual interaction variable may have several observa- tion variables if the pair appears in multiple assays. For those assays with binary observations, T ij .O n is a binary variable and the probability ... interaction assays. For these gold standard pairs, we fixed the value of the 'actual interaction& apos; variable accordingly. In all other protein pairs, we leave the actu...

Ngày tải lên: 14/08/2014, 08:20

... well-defined perturbation may lead immediately to a hypothesis regarding the underlying mechanism in the system under study. L2L is a database and associated software tool (Figure 1a) that systematically compares the ... D, Barrette T, Pandey A, Chinnaiyan AM: ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004, 6:1-6. 13. Edgar R, Dom...

Ngày tải lên: 14/08/2014, 14:22

... computer. Still, for most applications, image cytometry (automated cell image analysis) is strongly preferable to anal- ysis by eye. In fact, in some cases image cytometry is abso- lutely required ... interactions information Open Access 2006Carpenteret al.Volume 7, Issue 10, Article R100 Software CellProfiler: image analysis software for identifying and quantifying...

Ngày tải lên: 14/08/2014, 17:22