a new tool for quantifying anisotropic structures in bone images

... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... immunogenicity The PEGylation consists in binding with a covalent link a protein (adenosine-deaminase, asparaginase, interferons, granulocyte colonystimulating factor, liposomal doxyrubicin) to poly(ethylene) ... of activity Int J Med Sci 2007, 4 Rasburicase pharmacokynetics Information about pharmacokinetics derives by the use of rasburicase in children and young adults Few data are available in adults...

Ngày tải lên: 31/10/2012, 14:59

... Social Impact Bonds represent a potentially valuable new tool for scaling social impact tRacy palandJian CEO, Social Finance, Inc A New Tool for Scaling Impact u Executive Summary The United States ... implementation, including originating the deal, securing a government contract, structuring the instrument, and issuing the SIB They attract investment capital, for instance, by creating and facilitating access ... capital, shrinking government budgets, and the growth of impact investing—has paved the way for the development of an innovative financial instrument: the Social Impact Bond A New Tool for Scaling...

Ngày tải lên: 06/03/2014, 08:20

... [5,13,14] In conclusion, the CK19 mRNA based OSNA is a new and reliable method to determine metastatic disease in LN and can be applied as a rapid diagnostic tool during staging of CRC patients Acknowledgements ... supported data workup, statistical analysis and drafted the manuscript, VS was involved in technical assistance and in writing the manuscript, HD carried out H&E staining and CK19 IHC, CS coordinated ... was performed after the original analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA was isolated and subjected to qRT-PCR for CK19, CEA, and beta-actin Conditions...

Ngày tải lên: 18/06/2014, 16:20

... were attached to the base of this splint Scans were acquired using a Minolta Vivid 910 (Konica Minolta Sensing Americas, Inc., Ramsey, NJ, USA), a laser line triangulation scanner that produces a ... participated in study design, data acquisition, processing, analysis, and in preparation of the manuscript JE participated in data acquisition and analysis CKK participated in study design and ... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification...

Ngày tải lên: 09/08/2014, 10:22

... computationally easier than the general Page of 10 problem because timing incompatibilities cannot arise in a fixed timing For example, in the timing shown in Figure 3(b), a parasite associated ... name “Jane” is used to indicate that this tools is complementary to Tarzan.) Specifically, Jane uses a dynamic programming algorithm [1] that finds optimal solutions in polynomial time for any ... by applying Tarzan to several host-parasite problems in the literature In this paper, we describe a new approach to the cophylogeny reconstruction problem and a software package called Jane that...

Ngày tải lên: 12/08/2014, 17:20

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...

Ngày tải lên: 13/11/2014, 10:46

... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana ... growing and water availability was likely high after winter rains Total precipitation during March, April and May 1998 at site H was about 130 mm and air temperatures were between 15 and 25 °C In ... September 18 was a clear sunny day in all the areas selected for the study Images were obtained from USGS (United States Geological Survey) already georeferenced and radiometrically calibrated Images...

Ngày tải lên: 09/08/2014, 04:20

... obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes the energetic contribution of residues at a binding ... measurements The VH domains in camelid heavy chain antibodies are most similar to the classical VH3 family and as such bind protein A with micromolar affinity Furthermore, the protein A binding ... that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid heavy chain...

Ngày tải lên: 19/02/2014, 12:20

... Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical significance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma J Gastroenterol ... 24 Zhang T, Maekawa Y, Hanba J, Dainichi T, Nashed BF, Hisaeda H, Sakai T, Asao T, Himeno K, Good RA & Katunuma N (2000) Lysosomal cathepsin B plays an important role in antigen processing, while...

Ngày tải lên: 07/03/2014, 09:20

... learn, communicate and use information Without incorporating this understanding, programmes are likely to fail • Collaboration among agencies supporting traditional media and new ICTs can achieve ... bills), and support for software and hardware is absolutely necessary There is a need for budgetary planning awareness and integration of initiatives within budgetary cycles and strategic planning ... creatively express and share their personal and professional goals, in ways that allow all stakeholders to learn about one another’s goals Multi-stakeholder planning also involves internal participants...

Ngày tải lên: 08/03/2014, 20:20

... Health Organization was established in 1948 as a specialized agency of the United Nations serving as the directing and coordinating authority for international health matters and public health ... disease and the importance of food F ood plays a hugely important role in causing and preventing many diseases Eating an inadequate range of foods can lead to deficiency diseases, and contaminated ... (http://www.codexalimentarius.net/, accessed 13 September 2002) has elaborated many international standards WHO assists in a range of food-related activities, including the setting of international standards for trade in food...

Ngày tải lên: 16/03/2014, 14:20

... force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper are organized as follows In section we gives a summary of the FMM and related algorithms as well as ... dedicated hardware of similar kind (MD-ENGINE) has been reported, but its performance is rather modest [9] This is mainly because the hardware limitation Since dedicated hardware can calculate the particle ... section 3 A new formulation for fast calculation of far field force Eq (3) gives solution for outer expansion of P2 M2 Using a similar approach, we obtained solution for inner expansion as: p N...

Ngày tải lên: 22/03/2014, 11:20

... Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary a TFYR Macedonia Israel Uzbekistan Croatia Lithuania Republic of Moldova Azerbaijan Georgia ... Estonia Switzerland Lithuania Netherlands Ireland Germany Poland Austria Latvia Czech Republic Ukraine Slovenia Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania ... re-examined and refined and additional material added to the analysis They have the advantage of providing the basis for a democratic form of decision-making, and can increase the transparency of...

Ngày tải lên: 28/03/2014, 23:20

... collaboration Xiangdong Wang1*, Ena Wang2, Francesco M Marincola2 Abstract Translational Medicine is an emerging area comprising multidisciplinary Research from basic sciences to medical applications ... inter-disciplinary science is developing rapidly and widely and, in this article, we will place a special emphasis on China The development of Translational Medicine in China Translational Medicine is an ... quality Biobanks [4] and tools for data mining of existing information [5] Translational Medicine as an * Correspondence: xiangdong.wang@telia.com Department of Respiratory Medicine, Biomedical...

Ngày tải lên: 18/06/2014, 16:20

... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... obesity and heart disease Building local research capacity by establishing sustainable training programs/courses for students and physicians Developing and nurturing viable, collaborative partnerships...

Ngày tải lên: 18/06/2014, 19:20

... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... obesity and heart disease Building local research capacity by establishing sustainable training programs/courses for students and physicians Developing and nurturing viable, collaborative partnerships...

Ngày tải lên: 20/06/2014, 03:20

... classical variational inequality VI C, A In 2006, Aoyama et al first considered the following generalized variational inequality problem in Banach spaces Let A : C → X be an accretive operator ... 548–558, 2008 Y Yao, M A Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol 110, ... A3 problem 1.10 in a real Hilbert space Second, we introduce iteration process for finding a solution of a new general system of variational inequalities in a real Banach space Starting with arbitrary...

Ngày tải lên: 21/06/2014, 07:20

... of (a) the discriminant functions and (b) the associated cost function, for N = estimate, the eigenvalue variation can be still used, in a different form, for obtaining N The main idea behind ... outperforms the AIC and MDL criteria in terms of detection rate (Figure 5a) Figures 5b and 5c illustrate the mean estimate and variance variations They indicate a very interesting behavior of the new ... criteria for the case of a random number of superimposed sinusoids uniformly frequency spaced and having the same magnitude: (a) detection rate against white noise, (b) detection rate against colored...

Ngày tải lên: 23/06/2014, 01:20

... industry Additional results are available at www.relationshipera.com, and details of the Brand Sustainability Map research methodology are available at www.relationshipera.com/brand-sustainability/bsm-info/ ... product—they are passionate brand partners Principle #5: Engage Many marketers and agencies talk about an integrated approach to marketing, using a variety of tools to reach consumers In the Relationship ... digital music player and airline industries, we see a different way of thinking shaking up the marketing industry The new model of marketing—fostering sustainable relationships—represents a meaningful...

Ngày tải lên: 27/06/2014, 23:20

... the following updates in the forest management plan, little was changed in the already set principles and the floodplain forest was managed in the form of a composite forest with a rotation period ... producing a strong oak assortment In 1962, moreover, the National Forests set up a large pheasantry (1,340 ha) and due to the game management, the floodplain forest was classified as a special-purpose ... the assumption of a high abundance of oak in the floodplain forest at that period Intensive grazing was common in the floodplain forest until around 1850, when it was officially abolished In 1754,...

Ngày tải lên: 07/08/2014, 03:22