... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the dose of rasburicase, according to the various clinical states, the type of malignancy and ... half-life and further reduce immunogenicity The PEGylation consists in binding with a covalent link a protein (adenosine-deaminase, asparaginase, interferons, granulocyte colonystimulating factor,...
Ngày tải lên: 31/10/2012, 14:59
... interactions, and varying dimensions of risks, Social Impact Bonds represent a potentially valuable new tool for scaling social impact tRacy palandJian CEO, Social Finance, Inc A New Tool for Scaling ... PuBlIcPRIvate PaRtneRsHIPs In tHe WaKe oF tHe FInancIal cRIsIs, one tHat PRIvatIzes tHe RIsKs and sHaRes tHe gaIns FInancIal RIsK As described above, investors bear 100 percent of the financial risk in ... investors in the near term alternatively, corporations may agree to pay for outcomes if an intervention is beneficial to them Health insurers, for instance, may find it attractive to participate in an...
Ngày tải lên: 06/03/2014, 08:20
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
... material and requires a special training The OSNA lysate can be asservated and in unclear cases RNA isolation for further diagnostics is possible Our findings underline the requirement for a more ... technical support and drafted the manuscript, KEM and WH participated in patient recruitment and drafted the manuscript, AS scored the H&E staining and CK19 IHC of the LN All authors read and approved ... was performed after the original analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA was isolated and subjected to qRT-PCR for CK19, CEA, and beta-actin Conditions...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: " Kennedy Institute of Rheumatology Division, Imperial College London, 12–13 November 2003: Towards a molecular toolkit for studying lymphocyte function in inflammatory arthritis" ppt
... unfolds and that the peptidebinding groove can accommodate a peptide much longer than a nonamer Expression of HLA-B27 heavy chain in cells deficient in TAP (transporter associated with antigen ... are capable of recognising the HLA-B27 in this conformation Of great interest is the Available online http://arthritis-research.com/content/6/2/55 observation that homodimer tetramers also bind ... data from a murine model of inflammatory arthritis that suggested a role for regulatory T cells in the repression of arthritis and dermatitis Adult DBA/1 males were thymectomised and then treated...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... computationally easier than the general Page of 10 problem because timing incompatibilities cannot arise in a fixed timing For example, in the timing shown in Figure 3(b), a parasite associated ... of interest to the user include those for the rate at which timings are mutated in the genetic algorithm, among others These parameters are not exposed in the graphical user interface but can ... set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can import its files in either Tarzan or a Nexusbased...
Ngày tải lên: 12/08/2014, 17:20
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
Ngày tải lên: 13/11/2014, 10:46
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... for a more relaxed interaction since they can lean back on the couch Also many users are concerned about the quality of their handwriting and may avoid this input mode for that reason Another finding ... fields from the database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech ... System architecture The underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo hóa học: "A new low-complexity angular spread estimator in the presence of line-of-sight with angular distribution selection" pptx
... an antenna array (a) Two antenna elements of an antenna array at the base station with antenna elements at the base station (c) An antenna array with antenna elements at the base station (d) ... guration Figure Array structures considered by the new AS estimator a Two antenna-elements of an antenna array at the base station b The Varray: an antenna array with three antenna-elements at the ... (24) The final estimates for the mean AoA and AS is the mean of the obtained estimates associated with the Bousnina et al EURASIP Journal on Advances in Signal Processing 2011, 2011:88 http://asp.eurasipjournals.com/content/2011/1/88...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt
... first commercially available FIV vaccine (Fel-O-Vax FIV, Fort Dodge), approved for use in the USA, Japan, New Zealand and Australia The vaccine has attracted a degree of controversy as independent ... 5:77 GATTTTTAAGGTATTC (5' MLU) and either 5'-CGAGATATTATAACAGATGTTATTAGCACAT-3' (ENV 7076) or 5' GGTCTTGAATCTGTGAAGTGTACCACATA (ENV 7288) The amplification products were purified by agarose gel ... that, following concentration and paraformaldehyde inactivation, provided the first effective vaccine against FIV infec- tion [37], and the basis for the first commercial FIV vaccine, Fel-O-Vax...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo khoa học: "Individually Coded Telemetry: a Tool for Studying Heart Rate and Behaviour in Reindeer Calves" ppt
... calculates the HR, based either on the beatto-beat interval or a beat-to-beat timeaveraging algorithm, at 5-, 15- or 60-s intervals According to the manufacturer’s information the memory capacity ... Definition Lying Lying passively Standing Standing passively Locomotion Moving, walking or running Running Constant running under human harassment Eating Animal inside the feeding area ingesting feed ... generated pulse rate and the PVNV values, indicating a gradual adaptation to changes in generated pulse rate PVNV adjusts to changes in the pulse rate in about s but the lag varies with the pulse...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical significance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma J Gastroenterol ... intracellular localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with the...
Ngày tải lên: 07/03/2014, 09:20
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 4. ELECTRONIC NETWORKING IN COMMUNICATION FOR DEVELOPMENTNOTE pptx
... approaches and media choices Capacity building and institutional strengthening for intermediary organizations that serve rural and agricultural development is necessary so that they can make the most appropriate ... and facilitate the merging of global and local knowledge and information Support, create and strengthen interactive and collaborative networks that enable information to flow to and from rural ... creatively express and share their personal and professional goals, in ways that allow all stakeholders to learn about one another’s goals Multi-stakeholder planning also involves internal participants...
Ngày tải lên: 08/03/2014, 20:20
Food and health in Europe: a new basis for action pdf
... The World Health Organization was established in 1948 as a specialized agency of the United Nations serving as the directing and coordinating authority for international health matters and ... of and trends in food contamination; harmonizing data-reporting formats for chemical contaminants in food across Europe, as the first step in developing consistent and comparable assessments for ... programme geared to the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt
... dedicated hardware of similar kind (MD-ENGINE) has been reported, but its performance is rather modest [9] This is mainly because the hardware limitation Since dedicated hardware can calculate the particle ... force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper are organized as follows In section we gives a summary of the FMM and related algorithms as well as ... runs approximately faster than code A times for low accuracy and times for high accuracy Summary We have developed a new formulation and a new calculation procedure to speed up the calculation...
Ngày tải lên: 22/03/2014, 11:20
Food and health in Europe: a new basis for action pptx
... additional material added to the analysis They have the advantage of providing the basis for a democratic form of decision-making, and can increase the transparency of the processes and of the interests ... Estonia Switzerland Lithuania Netherlands Ireland Germany Poland Austria Latvia Czech Republic Ukraine Slovenia Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania ... Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary a TFYR Macedonia Israel Uzbekistan Croatia Lithuania Republic of Moldova Azerbaijan Georgia...
Ngày tải lên: 28/03/2014, 23:20
A retrospective data examination of customer loyalty in the e banking technology services industry strategies for new successes
... takes for success in e-business is fundamentally the same as what it takes for success in traditional business Many business leaders and researchers not argue the Internet to be a passing fad ... that customer satisfaction with a brand is a determinant of brand reputation in some situations In the insurance industry, for 10 instance, customer satisfaction with a brand is found to have a ... loyalty High switching costs retain customers from changing banking relationships Therefore, an increase in switching costs will lead to an increase in loyalty Since this is a kind of lock-in...
Ngày tải lên: 03/06/2014, 00:48
Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt
... Translational Medicine and integrated the information about Chinese data with the broader scope of the Journal of Translational Medicine All authors read and approved the final manuscript Wang ... Translational Medicine 2011 under the auspices of the new International Society for Translational Medicine [13] Remaining challenges to Translational efforts As in other countries, several challenges ... collaboration Xiangdong Wang1*, Ena Wang2, Francesco M Marincola2 Abstract Translational Medicine is an emerging area comprising multidisciplinary Research from basic sciences to medical applications...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: " Research Article Strong Convergence Theorem for a New General System of Variational Inequalities in Banach Spaces" pdf
... 548–558, 2008 Y Yao, M A Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol 110, ... A3 problem 1.10 in a real Hilbert space Second, we introduce iteration process for finding a solution of a new general system of variational inequalities in a real Banach space Starting with arbitrary ... variational inequalities 1.17 in a Banach space under some control conditions In order to prove our main result, the following lemmas are needed The next lemmas are crucial for proving the main theorem...
Ngày tải lên: 21/06/2014, 07:20