Báo cáo y học: "DHEA-dependent and organ-specific regulation

Báo cáo y học: "DHEA-dependent and organ-specific regulation of TNF-α mRNA expression in a murine polymicrobial sepsis and trauma model" pps

... expression in a murine polymicrobial sepsis and trauma model Tanja Barkhausen 1 , Frank Hildebrand 1 , Christian Krettek 1 and Martijn van Griensven 2 1 Department of Trauma Surgery, Hannover Medical ... Cioffi WG, Bland KI, Chaudry IH: Sex steroids regulate pro- and anti- inflammatory cytokine release by macrophages after trauma- hemorrhage. Am J Physiol 1999, 277:...

Ngày tải lên: 13/08/2014, 18:22

9 319 0

Báo cáo y học: "Insights into the regulation of intrinsically disordered proteins in the human proteome by analyzing sequence and gene expression data" potx

... correla- tion with functional characteristics and sequence attributes. Genome Res 2003, 13:1863-1872. 34. Raghavan A, Bohjanen PR: Microarray-based analyses of mRNA decay in the regulation of mammalian ... hetero-oligomerization and enzyme inhibitors that reduce the activity of proteases (that is, enzymes catalyzing the hydrolysis of peptide bonds) (Table 4). Protein disord...

Ngày tải lên: 14/08/2014, 21:20

18 326 0

Báo cáo y học: "Early Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts" potx

... TGGTGGCAAATCTTCCAAAAG Reverse CAATGACTTGGCAAAACATCCA Probe CATGATAACCCTCAAATATGTCCCCGGG Journal of Inflammation 2005, 2:15 http://www.journal-inflammation.com/content/2/1/15 Page 6 of 8 (page number ... TGTGTTCAGGCGCAGTATGG Reverse TCCCGAAGAGTGGTAACTGTAGC Probe CCTCGCCTCAAGGAGCCAGCC AREG 70 bp Forward ACTCGGCTCAGGCCATTATG Reverse AAAATGGTTCACGCTTCCCA Probe TGCTGGATTGGACCTCAATGACACCTACT KI...

Ngày tải lên: 11/08/2014, 08:21

8 383 0

Báo cáo y học: " Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes" ppsx

... cells [43]. Binding affinity assay of p65wt-tag and ΔNH 2 p65-tag to IκBα by using in vitro translated proteinsFigure 8 Binding affinity assay of p65wt-tag and ΔNH 2 p65-tag to IκBα by using in vitro translated ... neu- trophilic and monocytic proteinase 3 (PR3) removes the DNA-binding domain in the amino-terminus of p65/RelA by cleavage at a sequence near a caspase-3 cl...

Ngày tải lên: 13/08/2014, 05:21

20 315 0

Báo cáo y học: "Retroperitoneal packing as part of damage control surgery in a Danish trauma centre – fast, effective, and cost-effective" pot

... partici- pated in data collection and interpretation. EF was head of the trauma centre, revised the manuscript, and partici- pated in data collection and interpretation. All authors read and approved ... Hospital, Denmark, 3 Orthopaedic Department E, Aarhus University Hospital, Denmark and 4 Department of Anaesthesia and Intensive Care, Aarhus University Hospital, De...

Ngày tải lên: 13/08/2014, 23:20

4 327 0

Báo cáo y học: " The psychological well-being of Norwegian adolescents exposed in utero to radiation from the Chernobyl accident" pps

... prophylactic programs. In Radiation health risk sciences. Edited by: Nakashima M, Yamashita S, Nagayama Y, Tsukasaki K, Takamura, N. Springer, Tokyo, Japan; 2009:271-276. 23. Shibata Y: Twenty years ... conception and design of the study and supervised the analysis and interpretation of the data and drafts and revisions of the article. All authors read and approved the f...

Ngày tải lên: 13/08/2014, 18:21

8 237 0

Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"

... lo- cated in intron 3, has been recognized as the most important CYP 3A5 polymorphism. The alleles A and G are CYP 3A5 *1 and CYP 3A5 *3, respectively. Indi- viduals carrying at least one CYP 3A5 *1 allele ... 2010.05.11 Abstract Background: The aim of our study was to determine the impact of CYP 3A5 *1 and CYP 3A5 *3 on the kinetics of tacrolimus in renal transplant re...

Ngày tải lên: 26/10/2012, 09:32

7 787 0

Báo cáo y học: "Fibroblast activation protein alpha is expressed by chondrocytes following a pro-inflammatory stimulus and is elevated in osteoarthriti" docx

... 5'-ATC- TATGACCTTAGCAATGGAGAATTTGT-3' and 5'-GTTTT- GATAGACATATGCTAATTTACTCCCAAC-3'. The primers used for bovine FAP α were 5'-ACCATGAAAAGTGTGAAT- GCTTCA-3' and ... assayed as a measure of collagen degradation [10] and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [10]. Collagenase activity was determined by the...

Ngày tải lên: 09/08/2014, 07:20

8 344 0

Báo cáo y học: "Tumor necrosis factor α-induced adipose-related protein expression in experimental arthritis and in rheumatoid arthritis" pptx

... STEAP4 sense 5'-GCTCTC- CAGTCAGGAGCACT-3' and antisense 5'- CACACAGCACAGCAGACAAA-3', and GAPDH sense 5'- GAAGGTGAAGGTCGGAGTC-3' and antisense 5'-GAA- GATGGTGATGGGATTTC-3'. ... 5'-CCTA- CAGCCTCTGCTTACCG-3' and antisense 5'- GAGGGCAAAACAAGAGCAAG-3', STEAP3 sense 5'- GCCAGAAGAGATGGACAAGC-3' and antisense 5'-GGT-...

Ngày tải lên: 09/08/2014, 14:22

11 444 0

Báo cáo y học: " Genome-wide comparative analysis of the Brassica rapa gene space reveals genome shrinkage and differential loss of duplicated genes after whole genome triplicatio" potx

... At3L -A7 /A9 , At4L -A1 /A3 /A8 , and At5 -A2 / A3 /A1 0 (synteny view available at the URL cited in the 'Data used in this study' section in the Materials and methods. Additional synteny blocks scattered ... compli- cated mosaic pattern, indicating frequent recombination of Br chromosomes. Notable regions of synteny are shown in Figure 2b, and are At1S -A6 /A8 /A...

Ngày tải lên: 09/08/2014, 20:20

18 487 0