0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

Báo cáo khoa học:

Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

... exacts a heavy toll on the host in response to polymicrobial sepsis and L. monocytogenes. The receptor for advanced glycation endproducts (RAGE)plays central roles in the immune/inflammatory response. ... procedure. These data provide compelling evidence thatRAGE is not required for fundamental innate responses thatclear bacteria. Rather, RAGE may mediate hyperinflammatoryresponses to the invading bacteria ... micecompared with controls.CommentaryRAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenesRaphael Clynes1, Kevan Herold2 and Ann Marie Schmidt31Department...
  • 3
  • 286
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Central nervous system Toll-like receptor expression in response to Theiler''''s murine encephalomyelitis virus-induced demyelination disease in resistant and susceptible mouse strains" ppsx

... by the Laval University Animal Wel-fare Committee.Theiler's Murine encephalomyelitis virus preparation and intracerebral injection The plasmid containing the Daniel strain of TMEV was a generous ... York, ON, Canada)) and ImageJ software (version 1.23, W. Ras-band, National Institute of Health, Bethesda, MD, USA).O.D. for each pixel was calculated using a known standardof intensity and distance ... sections showing the strongest sig-nal were analyzed and averaged.Statistical analysisData were compiled and the statistical analysis was per-formed using SigmaStat (Systat, San Jose, CA) software(version...
  • 9
  • 333
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A Remark on the Blowup of Solutions to the Laplace Equations with Nonlinear Dynamical Boundary Conditions" pdf

... type partial differential operators with spectralparameters contained linearly in boundary conditions,” in Proceedings of the 8th InternationalSymposium on Algorithms and Computation (ISAAC ’97), ... M. Cavalcanti and V. N. D. Cavalcanti, “Existence and asymptotic stability f or evolution problems on manifolds with damping and source terms,” Journal of Mathematical Analysis and Applications, ... “Large time b ehavior of solutions of a semilinear parabolic equation with a nonlinear dynamical boundary condition,” in Topics in Nonlinear Analysis, vol. 35 of Progr. NonlinearDifferential...
  • 11
  • 317
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden" docx

... Mn and Fe in the trees were more influ-enced by a high water table than acid soil conditions.Anaerobic conditions can damage the roots and causelesions and both at Svenstorp and Ynde, dead and ... [30]. The solubility of Mn and Fe increases at lowpH and in anaerobic conditions [23]. This increases the concentration of cations in the water solution, and the part that is not taken up by the ... in length. The position on the terraininfluenced the concentration of Mn and Fe in the trees. Standard deviations are indicated on the bars, n = 12.Figure 2. N concentrations (mg/g) for control...
  • 8
  • 278
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Drotrecogin alfa (activated) should not be used in patients with severe sepsis and low risk for death" pdf

... by an Acute Physiology and Chronic Health Evaluation (APACHE II) score ≥ 25 or multiorgan failure. As a condition for approval, the manufacturer, Eli Lilly and Company, agreed to complete a ... Drotrecogin Alfa (Activated) in Early Stage Severe Sepsis (ADDRESS) study [1], Abraham and colleagues assessed the role of DrotAA in patients with severe sepsis and low risk of death. Subjects had ... phase IV studies evaluating the use of DrotAA in lower-risk patients with severe sepsis, in children with severe sepsis, and in patients receiving low-dose heparin [3]. In the Administration...
  • 3
  • 295
  • 0
Báo cáo y học:

Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc

... GTACAGGGTCTTGCGCAG 40Actin AFUA_6G04740 TCATCATGCGCGACAGC 10 CAATCATGATA*CCATGGTGAC 40b-tubulin AFUA_1G10910 CGACAACGAG*GCTCTGTACG 40 CAACTTGCGCAGATCAGAGTTGAG 40GpdA AFUA_5G01970 GGCGAGCTCAAGAACATCCTCGGCTA ... TGACCAAGGCT*GATTTGATC 40 CAACAAGGTAAGCAGAGTAG 40Asp f 13 AFUA_4G11800 GAGCGCAGAC*GTTGCCCATG 40 CCTTGTGGGAAATGCTGCCCAG 40Asp f 17 AFUA_4G03240 ACCATCAACTCCGGTGTCGAC 10 CTTGGAGATGAGGTCGTCG 40Asp f 18 AFUA_5G09210 ... GAAAGTCTCCTGAGGAGTG 10Asp f 10 AFUA_5G13300 GCGGCATTGCTG*ACACCGGC 40 GCAGGGGAAGACATAACCACCG 40Asp f 11 AFUA_2G03720 GGTCCTAACAC*CAACGGC 40 GAGCTTCGATCTCCTTGAC 40Asp f 12 AFUA_5G04170 TGACCAAGGCT*GATTTGATC...
  • 11
  • 285
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan-ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance.References1 ... Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, IndiaIntroduction The inability of the cell to degrade various stable mis-folded proteins leads to the formation of aggregates and ... (mea-sured as apparent rate constant) was accelerated. Thus,when a- synuclein was exposed to increasing concentra-tions of the neurotoxin, the rate of fibrillation wasenhanced. This may explain...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... and LAT. In addition, Csk and PAG, inhibitory molecules of the TCR signallingcascade, are also contained in the BCh-bound membranes. On the otherhand, CD3e, CD3f and Zap70 are localized in the ... Gomez-Mouton C, Abad JL, Mira E, Lacalle RA, Gal-lardo E, Jimenez-Baranda S, Illa I, Bernad A, Manes S& Martinez AC (2001) Segregation of leading-edge and uropod components into specific lipid rafts ... were alsocolocalized with these Src-kinases, accumulating in the BCh-bound membrane fraction. On the other hand,CD3e, CD3f and Zap70, main components of the TCRsignalling initiation machinery,...
  • 10
  • 588
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...
  • 12
  • 772
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... hybridi-zation of an oligo microarray containing 20 371 mousecDNAs. Scatter plot analysis of the microarray datashowed that most of the data points fell along the diagonal, indicating that most of the ... Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in ... mutations in various regions of oligo 3, oligo 6 and oligo 9(Table 3) and each mutated oligo was added to the gelretardation assay mixture to examine the competition to the binding of Six1 and probes...
  • 16
  • 476
  • 0

Xem thêm

Từ khóa: tuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP