Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

... exacts a heavy toll on the host in response to polymicrobial sepsis and L. monocytogenes. The receptor for advanced glycation endproducts (RAGE) plays central roles in the immune/inflammatory response. ... procedure. These data provide compelling evidence that RAGE is not required for fundamental innate responses that clear bacteria. Rather, RAGE may mediate hyper...

Ngày tải lên: 13/08/2014, 10:20

3 286 0
Báo cáo khoa học: "Central nervous system Toll-like receptor expression in response to Theiler''''s murine encephalomyelitis virus-induced demyelination disease in resistant and susceptible mouse strains" ppsx

Báo cáo khoa học: "Central nervous system Toll-like receptor expression in response to Theiler''''s murine encephalomyelitis virus-induced demyelination disease in resistant and susceptible mouse strains" ppsx

... by the Laval University Animal Wel- fare Committee. Theiler's Murine encephalomyelitis virus preparation and intracerebral injection The plasmid containing the Daniel strain of TMEV was a generous ... York, ON, Canada)) and ImageJ software (version 1.23, W. Ras- band, National Institute of Health, Bethesda, MD, USA). O.D. for each pixel was calculated using a known standa...

Ngày tải lên: 12/08/2014, 04:21

9 333 0
báo cáo hóa học:" Research Article A Remark on the Blowup of Solutions to the Laplace Equations with Nonlinear Dynamical Boundary Conditions" pdf

báo cáo hóa học:" Research Article A Remark on the Blowup of Solutions to the Laplace Equations with Nonlinear Dynamical Boundary Conditions" pdf

... type partial differential operators with spectral parameters contained linearly in boundary conditions,” in Proceedings of the 8th International Symposium on Algorithms and Computation (ISAAC ’97), ... M. Cavalcanti and V. N. D. Cavalcanti, “Existence and asymptotic stability f or evolution problems on manifolds with damping and source terms,” Journal of Mathematical Analysis...

Ngày tải lên: 21/06/2014, 11:20

11 317 0
Báo cáo khoa học: "Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden" docx

Báo cáo khoa học: "Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden" docx

... Mn and Fe in the trees were more influ- enced by a high water table than acid soil conditions. Anaerobic conditions can damage the roots and cause lesions and both at Svenstorp and Ynde, dead and ... [30]. The solubility of Mn and Fe increases at low pH and in anaerobic conditions [23]. This increases the concentration of cations in the water solution, and t...

Ngày tải lên: 08/08/2014, 14:21

8 279 0
Báo cáo khoa học: "Drotrecogin alfa (activated) should not be used in patients with severe sepsis and low risk for death" pdf

Báo cáo khoa học: "Drotrecogin alfa (activated) should not be used in patients with severe sepsis and low risk for death" pdf

... by an Acute Physiology and Chronic Health Evaluation (APACHE II) score ≥ 25 or multiorgan failure. As a condition for approval, the manufacturer, Eli Lilly and Company, agreed to complete a ... Drotrecogin Alfa (Activated) in Early Stage Severe Sepsis (ADDRESS) study [1], Abraham and colleagues assessed the role of DrotAA in patients with severe sepsis and low...

Ngày tải lên: 13/08/2014, 03:20

3 296 0
Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc

Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc

... GTACAGGGTCTTGCGCAG 40 Actin AFUA_6G04740 TCATCATGCGCGACAGC 10 CAATCATGATA*CCATGGTGAC 40 b-tubulin AFUA_1G10910 CGACAACGAG*GCTCTGTACG 40 CAACTTGCGCAGATCAGAGTTGAG 40 GpdA AFUA_5G01970 GGCGAGCTCAAGAACATCCTCGGCTA ... TGACCAAGGCT*GATTTGATC 40 CAACAAGGTAAGCAGAGTAG 40 Asp f 13 AFUA_4G11800 GAGCGCAGAC*GTTGCCCATG 40 CCTTGTGGGAAATGCTGCCCAG 40 Asp f 17 AFUA_4G03240 ACCATCAACTCCGGTGTCGAC 10 CTTGGAGATGAGG...

Ngày tải lên: 13/08/2014, 13:22

11 285 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... Pharmaceutical Education and Research (NIPER), S .A. S. Nagar, India Introduction The inability of the cell to degrade various stable mis- folded proteins leads to...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... and LAT. In addition, Csk and PAG, inhibitory molecules of the TCR signalling cascade, are also contained in the BCh-bound membranes. On the other hand, CD3e, CD3f and Zap70 are localized in the ... Gomez-Mouton C, Abad JL, Mira E, Lacalle RA, Gal- lardo E, Jimenez-Baranda S, Illa I, Bernad A, Manes S & Martinez AC (2001) Segregation of leading-edge and uropod com...

Ngày tải lên: 20/02/2014, 03:20

10 589 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... hybridi- zation of an oligo microarray containing 20 371 mouse cDNAs. Scatter plot analysis of the microarray data showed that most of the data points fell along the diagonal, indicating that most of the ... Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental pr...

Ngày tải lên: 07/03/2014, 17:20

16 476 0
w