Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf

... Access Review Host-virus interaction: a new role for microRNAs Vinod Scaria, Manoj Hariharan, Souvik Maiti, Beena Pillai and Samir K Brahmachari* Address: GN Ramachandran Knowledge Center for Genome Informatics, ... reported human microRNA which can cause abundance of Hepati- tis RNA [21] (vide infra). A recent report by Bhattacharyya et al suggests that microRNA mediated mec...

Ngày tải lên: 13/08/2014, 09:20

... for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine may enter in a sal- vage pathway, using hypoxanthine-guanine ... University of Catania, Catania, Italy Correspondence to: Mariano Malaguarnera, A. P., Via Messina 829 – 95125 Catania (Italy). Phone ++39 95 7262008; Fax ++39 95 7262011; E-Ma...

Ngày tải lên: 31/10/2012, 14:59

... lysine sidechains undergo acetylation, through the action of histone acetyltransferases, by way of acetyl coenzyme A, a step which is associated with transcriptional activation. These modifications ... Runx2-null phenotype. Commentary Histone deacetylases — a new target for suppression of cartilage degradation? John S Mort Shriners Hospital for Children; and Department of Surgery,...

Ngày tải lên: 09/08/2014, 06:23

... general, and of EGCG in particular, in arthritic/OA animal models.  e use of GTPs may be better than EGCG as GTPs may have synergistic eff ects, are more stable and are easily a ordable. It may also ... Katiyar SK, Raman C: Green tea: a new option for the prevention or control of osteoarthritis. Arthritis Research & Therapy 2011, 13:121. Katiyar and Raman Arthritis Research &...

Ngày tải lên: 12/08/2014, 17:22

... CTCCTCTCTTGACTCGC STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+] i HASMs (passage 4–5) were plated in black walled, ... varies between different types of smooth muscle, with SOC being particularly prominent in airway myocytes. The contractile/relaxant state of the airway myocyte is a key determinant of airw...

Ngày tải lên: 12/08/2014, 16:20

... Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure. Finland Helsinki; 2005, 56. 7. Kuisma K, Boyd J, Väyrynen ... from the former system, which had municipality-based centers, covered the years 2002-2005 and was collected from several databases. From the new EMCC, data was collected from January 1 to...

Ngày tải lên: 25/10/2012, 10:02

... 10.1186/1744-859X-9-25 Cite this article as: Cocchi et al., Human depression: a new approach in quantitative psychiatry Annals of General Psychiatry 2010, 9:25 Cocchi et al. Annals of General Psychiatry 2010, 9:25 http://www.annals-general-psychiatry.com/content/9/1/25 Open ... Grant B, Hoffman PL, Tabakoff B: Platelet adenylyl cyclase activity as a trait marker of alcohol dependence....

Ngày tải lên: 08/08/2014, 23:21

... the majority of RA patients [30]. In a randomized study patients with active RA were treated for 2 weeks with a highly specific CCR1 antagonist or placebo [29]. Synovial tissue analysis revealed a ... and other chronic inflammatory disorders. Keywords: chemokines, rheumatoid arthritis, synovial tissue 97 21. Ogata H, Takeya M, Yoshimura T, Takagi K, Takahashi K: The role of monocyte...

Ngày tải lên: 09/08/2014, 01:23

... Nakamura K, Tokunaga Y, Hanada S, Kumemura H, Maeyama M, Harada M, Ogata H, Yano H, Kojiro M, Ueno T, Yoshimura A, Sata M: Spreds, inhibitors of the Ras/ERK signal transduction, are dysregulated ... strains. Discussion RA histology is typically characterized by pronounced synovial hyperplasia, also called 'pannus'. The RA pannus produces proinflammatory cytokines and proteases, a...

Ngày tải lên: 09/08/2014, 10:23

... heterogeneous data sets [8]. This particular study tried to match disease complexity of patient infor- mation, clinical data, standard laboratory evaluations, brain imaging data and genetic data obtained ... health- care, enable researchers to search online biological databases and use bioinformatics in medical practice, select appropriate software to analyze the microarray data for medical...

Ngày tải lên: 10/08/2014, 09:22