Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf
Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf
... AccessReview Host-virus interaction: a new role for microRNAsVinod Scaria, Manoj Hariharan, Souvik Maiti, Beena Pillai and Samir K Brahmachari*Address: GN Ramachandran Knowledge Center for Genome Informatics, ... reportedhuman microRNA which can cause abundance of Hepati-tis RNA [21] (vide infra). A recent report by Bhattacharyyaet al suggests that microRNA mediated mechanism ofpost-transcriptional repression ... significance of these microR-NAs and their roles in alternatively spliced transcripts areyet to be addressed.MaturationMicroRNAs are transcribed by RNA Polymerase II as pri-mary microRNAs (pri-miRNAs)...
- 9
- 340
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine may enter in a sal-vage pathway, using hypoxanthine-guanine ... University of Catania, Catania, Italy Correspondence to: Mariano Malaguarnera, A. P., Via Messina 829 – 95125 Catania (Italy). Phone ++39 95 7262008; Fax ++39 95 7262011; E-Mail: malaguar@unict.it ... 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras-buricase, according to the various clinical states, the type of malignancy and drugs...
- 11
- 715
- 0
Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf
... lysinesidechains undergo acetylation, through the action of histoneacetyltransferases, by way of acetyl coenzyme A, a stepwhich is associated with transcriptional activation. Thesemodifications ... Runx2-nullphenotype.CommentaryHistone deacetylases — a new target for suppression of cartilagedegradation?John S MortShriners Hospital for Children; and Department of Surgery, McGill University; Montreal, ... metalloproteinases.Available online http://arthritis-research.com/contents/7/4/155AbstractIncreased expression of metalloproteinases is a fundamental aspectof arthritis pathology and its control is a...
- 2
- 397
- 0
Báo cáo y học: "Green tea: a new option for the prevention or control of osteoarthritis" ppt
... general, and of EGCG in particular, in arthritic/OA animal models. e use of GTPs may be better than EGCG as GTPs may have synergistic eff ects, are more stable and are easily a ordable. It may also ... Katiyar SK, Raman C: Green tea: a new option for the prevention or control of osteoarthritis. Arthritis Research & Therapy 2011, 13:121.Katiyar and Raman Arthritis Research & Therapy ... disease exacerbation in a mouse model of OA, suggesting both a catabolic and an anabolic role for IL-1β [7].Akhtar and Haqqi also showed that GTPs reduce IL-1β-induced granulocyte–macrophage...
- 2
- 338
- 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx
... CTCCTCTCTTGACTCGCSTIM-2 forward primer: ACGACACTTCCCAGGATAGCAreverse primer: GACTCCGGTCACTGATTTTCAACprobe: TGCACGAACCTTCATTMeasurement of [Ca2+]iHASMs (passage 4–5) were plated in black walled, ... variesbetween different types of smooth muscle, with SOCbeing particularly prominent in airway myocytes. Thecontractile/relaxant state of the airway myocyte is a keydeterminant of airway calibre thus contributing ... Ian.Hall@nottingham.ac.uk* Corresponding author AbstractBackground: Control of cytosolic calcium plays a key role in airway myocyte function. Changesin intracellular Ca2+ stores can modulate contractile...
- 8
- 341
- 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... Handbooks of the Ministry of Social Affairs and Health Ambulance andemergency care services: A handbook for drawing up an alarmprocedure. Finland Helsinki; 2005, 56.7. Kuisma K, Boyd J, Väyrynen ... from theformer system, which had municipality-based centers, covered the years 2002-2005 and was collected from severaldatabases. From the new EMCC, data was collected from January 1 to May 31, ... munici-pality-based centers but was not regularly monitored andstandardized as in the new EMCC organization.The aim of this study was to evaluate if the perfor-mance in emergency medical dispatching...
- 5
- 495
- 0
Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf
... 10.1186/1744-859X-9-25Cite this article as: Cocchi et al., Human depression: a new approach in quantitative psychiatry Annals of General Psychiatry 2010, 9:25Cocchi et al. Annals of General Psychiatry 2010, 9:25http://www.annals-general-psychiatry.com/content/9/1/25Open ... Grant B, Hoffman PL, Tabakoff B: Platelet adenylyl cyclase activity as a trait marker of alcohol dependence. Alcohol Clin Exp Res 2000, 24:810-821.34. Hines LM, Tabakoff B: Platelet adenylyl ... intracellular event (for example, activation of adenylate cyclase).Cocchi et al. Annals of General Psychiatry 2010, 9:25http://www.annals-general-psychiatry.com/content/9/1/25Page 5 of 6objective...
- 6
- 435
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... themajority of RA patients [30]. In a randomized studypatients with active RA were treated for 2 weeks with a highly specific CCR1 antagonist or placebo [29]. Synovialtissue analysis revealed a ... and other chronic inflammatory disorders.Keywords: chemokines, rheumatoid arthritis, synovial tissue9721. Ogata H, Takeya M, Yoshimura T, Takagi K, Takahashi K: The role of monocyte chemoattractant ... cells are scatteredthroughout the rheumatoid synovium, and most of theCCR1-positive cells are macrophages, which play a key role in synovial inflammation. The rationale for the clinicalstudy was...
- 5
- 460
- 0
Báo cáo y học: "Cia5d regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature" pptx
... Nakamura K, Tokunaga Y, Hanada S, Kumemura H, Maeyama M, Harada M, Ogata H, YanoH, Kojiro M, Ueno T, Yoshimura A, Sata M: Spreds, inhibitors ofthe Ras/ERK signal transduction, are dysregulated ... strains.DiscussionRA histology is typically characterized by pronounced synovialhyperplasia, also called 'pannus'. The RA pannus producesproinflammatory cytokines and proteases, and invades carti-lage ... expression analysiswas conducted to identify genes and pathways that are differ-entially expressed between highly invasive DA and minimallyinvasive DA.F344(Cia5d) FLSs. The analysis revealed that...
- 14
- 337
- 0
Báo cáo y học: "Clinical bioinformatics: a new emerging science" pot
... heterogeneous data sets [8]. This particularstudy tried to match disease complexity of patient infor-mation, clinical data, standard laboratory evaluations,brain imaging data and genetic data obtained ... health-care, enable researchers to search online biologicaldatabases and use bioinformatics in medical practice,select appropriate software to analyze the microarraydata for medical decision-making, ... simultaneousevaluation of clinical and basic research could improvemedical care, care provision data, and data exploitationmethods in d isease therapy and algorithms for the ana-lysis of such...
- 3
- 264
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyena new role for supervisory authoritiesforces receptor ligand leverage and a new role for stress fiberstissue banking a new role for the transfusion servicebáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam