Báo cáo khoa học: "Heterotopic ossification – a long-term consequence of prolonged immobility" pdf

... Donath A, Vasey H, Taillard W, Lagier R, et al.: Current facts of para-osteo-arthropathy (POA). Paraplegia 1973, 11:38-78.9. Kaplan FS, Glaser DL, Hebela N, Shore EM: Heterotopic ossifi-cation. ... survivors of the acute respiratorydistress syndrome. N Engl J Med 2003, 348:683-693.6. Sugita A, Hashimoto J, Maeda A, Kobayashi J, Hirao M, MasuharaK, Yoneda M, Yoshikawa H: Heterotopic ossification ... imaging. Crit Care 2006, 10:R152.2. Cheung AM, Tansey CM, Tomlinson G, Diaz-Granados N, Matte-Martyn A, Mehta S, Mazer D, Guest CB, Stewart TE, Al-Saidi F, etal.; for the Canadian Critical...

báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

... 5:453http://www.jmedicalcasereports.com/content/5/1/453Page 4 of 4unable to actively perform a straight leg raise. On pal-pation, there was generalize d tenderness and a highriding patella with a palpable gap ... 71(5):1460-1464.doi:10.1186/1752-1947-5-453Cite this article as: Chen and Chmell: Heterotopic ossification afterpatellar tendon repair in a man with trisomy 8 mosaicism: a case reportand literature review. Journal of Medical Case Reports ... deteriorating range of mot ion,plantar and dorsiflexion remained intact. Sensation wasintact and there was brisk capillary refill.At this time o ur patient was given the opt ion of leav-ing...

Báo cáo khoa học: "Heterotopic ossification of the knee joint in intensive care unit patients: early diagnosis with magnetic resonance imaging" docx

... imagingMaria I Argyropoulou1, Eleonora Kostandi2, Paraskevi Kosta1, Anastasia K Zikou1, Dimitra Kastani2, Efi Galiatsou2, Athanassios Kitsakos2 and George Nakos21Department of Radiology, ... because of the sedation and immo-bilisation of the patients. The laboratory findings, such as anincrease in serum ALP, are also non-specific. HO can be a cause of fever in ICU patients and may ... received daily assessment of joint mobilityand appropriate passive range -of- motion exercises. Serum lev-els of alkaline phosphatase (ALP), calcium, and phosphoruswere also measured on a daily basis....

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... basement membranes. Histochem Cell Biol 113,11 5–1 24.52 Nagahama H, Hatakeyama S, Nakayama K, Nagata M,Tomita K & Nakayama K (2001) Spatial and temporalexpression patterns of the cyclin-dependent ... oligocDNA probe and a sense cDNA probe (complementary tothe antisense) for mouse Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, ... Ozaki H, Watanabe Y, Takahashi K, Kitamura K,Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J,Asano M et al. (2001) Six4, a putative myogenin generegulator, is not essential for mouse embryonal...

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, speciﬁcally expressed in the olfactory epithelium in a zone-speciﬁc manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse);MACS1 5¢-gagttggagctccaagctgg-3¢ (forward), ... 71 3–7 23.7. Serizawa, S., Ishii, T., Nakatani, H., Tsuboi, A. , Nagawa, F.,Asano, M., Sudo, K., Sakagami, J., Sakano, H., Ijiri, T.,Matsuda, Y., Suzuki, M., Yamamori, T., Iwakura, Y. & Sakano,H....

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Unification-Based Formalism. Ph.D. disser- tation, University of Texas at Austin.[Some of this material is available ... 1987. A Lazy Way to Chart Parse with Categorial Grammars, this volume. Pollard, C. 1984. Generalized Phrase Structure Gram- mars, Head Grammars, and Natural Languages. Ph.D. dissertation, Stanford ... capacity of the gram- mars that Steedman assumes, say, for Dutch, is in the same class with Tree Adjoining Grammars (Joshi 1985) and Head Grammars (Pollard 1984). Thus, computational tractability...

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... purchased from Tian-jin Saier Biotech and Sigma-Aldrich.Statistical analysisData are expressed as mean ± standard deviation (SD),and P < 0.05 is considered to be statistically signiﬁcantwith...

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... of untreated Avicel.Multivariate statistical analysis of X-ray dataThe CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous cellulose (PASC) andAvicel ... 105,11 5–1 25.58 Bansal P, Hall M, Realff MJ, Lee JH & BommariusAB (2010) Multivariate statistical analysis of X-ray datafrom cellulose: a new method to determine degree of crystallinity and ... 112 2–1 128.28 Bommarius AS, Katona A, Cheben SE, Patel AS,Ragauskas AJ, Knudson K & Pu Y (2008) Cellulasekinetics as a function of cellulose pretreatment. MetabEng 10, 37 0–3 81.29 Mansﬁeld...

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... 276, 1331 4–1 3321.12 Dean N (1995) Yeast glycosylation mutants are sensitiveto aminoglycosides. Proc Natl Acad Sci USA 92, 128 7– 1291.13 Gaxiola RA, Rao R, Sherman A, Grisaﬁ P, Alper SL &Fink ... (1999) The Arabidopsis thaliana proton trans-porters, AtNhx1 and Avp1, can function in cationdetoxiﬁcation in yeast. Proc Natl Acad Sci USA 96 ,148 0–1 485.14 Madrid R, Gomez MJ, Ramos J & Rodriguez-Navarro A ... IshakKG & Dalakas MC (1992) Parenchymal organ cystinedepletion with long-term cysteamine therapy. BiochemMedical Metab Biol 48, 27 5–2 85.8 Gahl WA (2003) Early oral cysteamine therapy...

Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

... the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are ... the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.). The comprehension of metaphor does not require a special set of processes ... theories of metaphor within linguistics and psychology. 4. CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ