Báo cáo khoa học: "Heterotopic ossification – a long-term consequence of prolonged immobility" pdf

Báo cáo khoa học: "Heterotopic ossification – a long-term consequence of prolonged immobility" pdf

Báo cáo khoa học: "Heterotopic ossification – a long-term consequence of prolonged immobility" pdf

... Donath A, Vasey H, Taillard W, Lagier R, et al.: Current facts of para-osteo-arthropathy (POA). Paraplegia 1973, 11:38-78. 9. Kaplan FS, Glaser DL, Hebela N, Shore EM: Heterotopic ossifi- cation. ... survivors of the acute respiratory distress syndrome. N Engl J Med 2003, 348:683-693. 6. Sugita A, Hashimoto J, Maeda A, Kobayashi J, Hirao M, Masuhara K, Yoneda M, Yoshikawa H: Heterotopi...

Ngày tải lên: 13/08/2014, 03:20

2 301 0
báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

báo cáo khoa học: "Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mosaicism: a case report and literature review" pptx

... 5:453 http://www.jmedicalcasereports.com/content/5/1/453 Page 4 of 4 unable to actively perform a straight leg raise. On pal- pation, there was generalize d tenderness and a high riding patella with a palpable gap ... 71(5):1460-1464. doi:10.1186/1752-1947-5-453 Cite this article as: Chen and Chmell: Heterotopic ossification after patellar tendon repair in a man with trisomy 8 mos...

Ngày tải lên: 10/08/2014, 23:20

4 252 0
Báo cáo khoa học: "Heterotopic ossification of the knee joint in intensive care unit patients: early diagnosis with magnetic resonance imaging" docx

Báo cáo khoa học: "Heterotopic ossification of the knee joint in intensive care unit patients: early diagnosis with magnetic resonance imaging" docx

... imaging Maria I Argyropoulou 1 , Eleonora Kostandi 2 , Paraskevi Kosta 1 , Anastasia K Zikou 1 , Dimitra Kastani 2 , Efi Galiatsou 2 , Athanassios Kitsakos 2 and George Nakos 2 1 Department of Radiology, ... because of the sedation and immo- bilisation of the patients. The laboratory findings, such as an increase in serum ALP, are also non-specific. HO can be a cause of fever in I...

Ngày tải lên: 13/08/2014, 03:20

6 259 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... basement membranes. Histochem Cell Biol 113, 11 5–1 24. 52 Nagahama H, Hatakeyama S, Nakayama K, Nagata M, Tomita K & Nakayama K (2001) Spatial and temporal expression patterns of the cyclin-dependent ... oligo cDNA probe and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGA...

Ngày tải lên: 07/03/2014, 17:20

16 476 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢)forMACS1, ... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaac gcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctggga agcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse); MACS1 5¢-gagttggagc...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Unification-Based Formalism. Ph.D. disser- tation, University of Texas at Austin.[Some of this material is available ... 1987. A Lazy Way to Chart Parse with Categorial Grammars, this volume. Pollard, C. 1984. Generalized Phrase Structure Gram- mars, Head Grammars, and Natural Languages. Ph.D. d...

Ngày tải lên: 08/03/2014, 18:20

8 355 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTG MicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTT...

Ngày tải lên: 14/03/2014, 23:20

11 397 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... of untreated Avicel. Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quanti- fying the contribution of amorphous cellulose (PASC) and Avicel ... 105, 11 5–1 25. 58 Bansal P, Hall M, Realff MJ, Lee JH & Bommarius AB (2010) Multivariate statistical analysis of X-ray data from cellulose: a new method to determine degree of c...

Ngày tải lên: 15/03/2014, 10:20

12 554 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... 276, 1331 4–1 3321. 12 Dean N (1995) Yeast glycosylation mutants are sensitive to aminoglycosides. Proc Natl Acad Sci USA 92, 128 7– 1291. 13 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL & Fink ... (1999) The Arabidopsis thaliana proton trans- porters, AtNhx1 and Avp1, can function in cation detoxification in yeast. Proc Natl Acad Sci USA 96 , 148 0–1 485. 14 Madrid R, Gomez MJ...

Ngày tải lên: 16/03/2014, 18:20

15 378 0
Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

... the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are ... the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.). The comprehension of metaphor does not require a special set of...

Ngày tải lên: 17/03/2014, 19:20

2 311 0
Từ khóa:
w