Báo cáo khoa học: "What is a pressure–volume curve" ppt

... used is markedly higher than the plateau pressure during the course of mechanical ventilation. Among different patients, Papazian’s group found sustained increases in PaO 2 , decreases in PaO 2 and ... increases in PaCO 2 . Although it is difficult to speculate without having more precise data from these patients, several mechanisms can be at work explaining these effects. An increase in...

Ngày tải lên: 13/08/2014, 02:24

... quantita- tive data analyses. Instead a descriptive summary is presented [13,18]. Summary of research on quality and safety teams in acute care To assist in the description and analysis, papers ... Michael’s Hospital, Toronto, Ontario, Canada. 3 Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada. 4 Health Systems and Workforce Research Unit, Alberta Health Services, Calg...

Ngày tải lên: 10/08/2014, 11:20

... 25 2.2 2 1.8 1.4 1.2 1.6 1 0.8 0.6 0.4 0.2 0 A 600 A 600 A 600 Time (h) Fig. 5. His41 is essential for Paracoc- cus pantotrophus NirF, but Asp129 is dis- pensable. Growth plots and time courses of nitrite appearance and disappearance ... in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d...

Ngày tải lên: 15/02/2014, 01:20

... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of t...

Ngày tải lên: 07/03/2014, 05:20

... NANOGP8 60 50 40 30 20 10 0 Mock Mock NANOGP8 NANOGP8 1.8 A B 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 day 1 day 2 day 3 day 4 % Absorbance S stage percentage Fig. 6. FACS analysis results. FACS analysis of cells transfected with NANOGP8 and the mock ones (A) and the MTT assay (B). The percentage ... instuctions. Total RNA was digested with RNAase-free DNase I (TaKaRa Carlsbad, CA, USA) at 37°C for...

Ngày tải lên: 07/03/2014, 12:20

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGT...

Ngày tải lên: 07/03/2014, 15:20

... as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols described in this study were approved by ... 110, 151–164. 26 Tomari S, Nagahama H, Shu Y, Hoshi S, Nakayama K, Nakayama KI & Nagata M (2002) Glomerular dif- ferentiation in p27 and p57 double-mutant metanephroi. Anat Embryol 206, 3...

Ngày tải lên: 07/03/2014, 17:20

... used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; ... 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢. Protein expression and purification The TIM gene carrying the mutation was expressed in E. coli...

Ngày tải lên: 14/03/2014, 23:20

... transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12]. Consistent with this ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C) Quantitation analysis for GST–hhLIM association with F-actin at different concentrations ....

Ngày tải lên: 16/03/2014, 06:20

... amylin to evaluate its effect on amylin aggregation. Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scat- tering assays and HPLC analysis at selected ... formation. A detailed view of the early stage of aggregation was obtained with the ThT assay (Fig. 2), which shows similar kinetic features as the light scattering assay. The data show that insu...

Ngày tải lên: 23/03/2014, 04:21