Báo cáo khoa học: " icuroom net – a new critical care addendum" docx
Báo cáo khoa học: " icuroom.net – a new critical care addendum" docx
... provides professional evidence based critical care practice guidelines. Critical Care Evidence-Based Medicine Journal Club – http://ccforum.com/articles/browse.asp?sort=Journal+club+ critique This ... provides an editorial of published articles based on the University of Pittsburgh’s journal club’s critique of the current published literature. Competing interests The author(s) dec...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo khoa học: "Innovations in technology for critical care medicine" docx
... Ontario, Canada 2 Specialist, Intensive Care Services, Royal Prince Alfred Hospital, Missenden Road, Camperdown, Australia 3 Consultant in Intensive Care Medicine and Anaesthesia, Northwick Park ... central airways with multidetector CT. AJR Am J Roentgenol 2002, 179:301-308. 8. Nakamori Y, Hayakata T, Fujimi S, Satou K, Tanaka C, Ogura H, Nishino M, Tanaka H, Shimazu T, Sugimoto H: Trach...
Ngày tải lên: 12/08/2014, 20:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ....
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse ... CGGGATCCTCTTGTATTACCCTCTA PPP6C-3¢UTR-antisense GCGAATTCTCCATCGTGCC PPP6C-3¢UTR-mut-sense TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... sentences as a test corpus. 4.2 Language model and paraphrase table Paraphrase generation tools based on SMT meth- ods need a language model and a paraphrase table. Both are computed on a training ... paraphrase generation. In order to produce paraphrases, a promising approach is to see the paraphrase generation prob- lem as a translation problem, where the target lan- guage is th...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. The forward primer incorporated an NdeI site and the ... cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc
... of analytical grade and were acquired from Merck KGaA (Darmstadt, Germany) and J T Baker Italia (Milan, Italy). Enzyme assays and identification of reaction products Enzyme assays The AMP–AMP phosphotransferase ... cancer patients Table 3 shows the activities of AdK, MK, ADA and AMP–AMP phosphotransferase in normal and cancer- ous human colorectal mucosa. The MK activity did not vary, but the...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... template and the following primers: mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The gene mm0632 was cloned via ... monofunctional catalase from Methanosarcina barkeri. Arch Microbiol 171, 31 7–3 23. 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barker...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps
... Germany is characterised by a subatlantic climate with an annual precipitation of 700 mm and a mean annual temperature of 14.5 °C. The soil is a poor sandy pleistocene podsolic cambisol (FAO). ... experimental plots. Spacing Plants per ha Current density Characterisation 1.4 m × 0.3 m 23810 plants ha –1 19700 plants ha –1 “narrow spaced” 1.4 m × 0.5 m 14826 plants ha –1 1...
Ngày tải lên: 08/08/2014, 14:22
báo cáo khoa học: " Implementation of a new cost efficacy method for blood irradiation using a non dedicated device" pptx
... 6 RESEARCH Open Access Implementation of a new cost efficacy method for blood irradiation using a non dedicated device Paola Pinnarò 1 , Antonella Soriani 2 , Daniela D’Alessio 2 , Carolina Giordano 1 , ... set-up To facilitate and standardize the blood component irra- diation using a line ar accelerator, a blood irradiator box was designed and made of Polymethylmethacrylate (PMMA)....
Ngày tải lên: 10/08/2014, 10:20