Báo cáo khoa học: "Clinical review: A systematic review of corticosteroid use in infections" ppt

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... rather than adsorption on the enzymatic rate. Thus, the cellulase activity and initial rate data obtained from various samples may provide valuable information about the details of the mecha- nistic ... of untreated Avicel. Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quanti- fying the contribution of amorphous cellulose (PASC)...

Ngày tải lên: 15/03/2014, 10:20

12 554 0
Báo cáo khoa học: "Clinical review: A systematic review of corticosteroid use in infections" ppt

Báo cáo khoa học: "Clinical review: A systematic review of corticosteroid use in infections" ppt

... CD000972. 58. Warrell DA, Looareesuwan S, Warrell MJ, Kasemsarn P, Intara- prasert R, Bunnag D, Harinasuta T: Dexamethasone proves deleterious in cerebral malaria: a double blind trial in 100 comatose patients. ... above, a recent Cochrane systematic review and accompanying publication re-examined the use of corticosteroids in septic shock [10,11]. Although there was Review...

Ngày tải lên: 12/08/2014, 23:20

10 251 0
báo cáo khoa học: " Protocol: developing a conceptual framework of patient mediated knowledge translation, systematic review using a realist approach" doc

báo cáo khoa học: " Protocol: developing a conceptual framework of patient mediated knowledge translation, systematic review using a realist approach" doc

... Correspondence: anna.gagliardi@uhnresearch.ca 1 Departments of Health Policy, Management and Evaluation, University of Toronto, Toronto, Canada Full list of author information is available at the end of the ... proposal, and obtained funding. ARG will lead and coordinate data collection and analysis, interpretation, and report writing. She will be the primary investigator to independe...

Ngày tải lên: 10/08/2014, 10:23

5 296 0
Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx

Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx

... adenocarcinoma arising in Barrett's esophagus (BE) may indicate the carcinogenesis pathway. The aim of this study was to evaluate resected specimens of adenocarcinoma in BE for the pattern of ... proximal Adenocarcinoma over a long Bar-rett's EsophagusFigure 6 An infiltrative proximal Adenocarcinoma over a long Barrett's Esophagus. Undifferentiated adenocarcinoma...

Ngày tải lên: 09/08/2014, 04:21

8 410 0
Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

... trial seems to be meant to amuse rather than being a scientific study [4], in line with the tradition of this special issue, as the trial evaluated the effect of prayer taking place 4–10 years after ... life again. In fact, all the randomi- sation did was to divide the living and the dead into two groups that were then compared statistically. This is meaningless[4], also because we...

Ngày tải lên: 11/08/2014, 07:21

4 207 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we could not manually annotate a large portion of the MZEE cor- pus, the training data consisted of ... (anglicisms) are used in a German- language Internet hip hop forum, and what factors contribute to their uptake. 1 Introduction Because English has established itself as something of...

Ngày tải lên: 19/02/2014, 19:20

5 538 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols ... site. Proc Natl Acad Sci USA 95, 14220–14225. 18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their...

Ngày tải lên: 07/03/2014, 17:20

16 476 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢) and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢) for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢)forMACS1, ... Fujino, T., Takei, Y .A. , Sone, H., Ioka, R.X., Kamataki, A. , Magoori, K., Takahashi, S., Sakai, J. & Yamamoto, T.T. (2001) Molecular identification and characterization...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... combinators, that replace the basic forms of functional composition and type raising in the original grammar. After first reviewing the theory of Combinatory Categorial Grammar and the attendant ... Categorial Unification Grammars. In Proceedings of Coling 1986, pp. 187-194. Wittenburg, K. 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Uni...

Ngày tải lên: 08/03/2014, 18:20

8 355 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG PPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward ... MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma Nannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu,...

Ngày tải lên: 14/03/2014, 23:20

11 397 0
w