0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: ":Bench-to-bedside review: A brief history of clinical acid–base" pps

Báo cáo khoa học:

Báo cáo khoa học: ":Bench-to-bedside review: A brief history of clinical acid–base" pps

... now atthe heart of the debate over the Stewart approach toacid–base physiology almost half a century later [18,19].All have agreed for decades that changes in the partialpressure of carbon ... Henderson–Hasselbalch equation. pH, plasma pH; pKa, negativelog to base 10 of the apparent, overall dissociation constant of carbonic acid; [HCO3–], plasma bicarbonate concentration; α,solubility of ... thumb’ are not as easilyamenable to this kind of quantitative analysis.The Stewart approach may provide a better understanding of not only the mechanisms of acid–base disorders, but also thevarious...
  • 6
  • 280
  • 0
báo cáo khoa học:

báo cáo khoa học: " Protocol: developing a conceptual framework of patient mediated knowledge translation, systematic review using a realist approach" doc

... anna.gagliardi@uhnresearch.ca1Departments of Health Policy, Management and Evaluation, University of Toronto, Toronto, CanadaFull list of author information is available at the end of the articleGagliardi ... to patient needs and values. Characterization and evaluation of strategies for involving patientsin their healthcare may benefit from a knowledge translation (KT) approach. The purpose of this ... Open AccessProtocol: developing a conceptual framework of patient mediated knowledge translation,systematic review using a realist approachAnna R Gagliardi1*, France Légaré2, Melissa C...
  • 5
  • 296
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACATCCTTGGTACCAGGTGATTTTTCTTGTGAAGAT.All experimental protocols described in this study wereapproved by ... 110, 151–164.26 Tomari S, Nagahama H, Shu Y, Hoshi S, NakayamaK, Nakayama KI & Nagata M (2002) Glomerular dif-ferentiation in p27 and p57 double-mutant metanephroi.Anat Embryol 206, 31–36.27 ... site.Proc Natl Acad Sci USA 95, 14220–14225.18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H,Sato S & Kawakami K (1999) Cooperation of Six andEya in activation of their target genes through...
  • 16
  • 476
  • 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse);MACS1 5¢-gagttggagctccaagctgg-3¢ (forward), ... OCAM5¢-gagaagtggtgtcccctcaa-3¢ (forward), 5¢-cctccatcatcttgcttggt-3¢ (reverse); NCAM 5¢-cttcctgtgtcaagtggcag-3¢ (for-ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD5¢-aagacgcatgaaggccaatg-3¢...
  • 10
  • 393
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "PREDICTIVE COMBINATORS A METHOD PROCESSING OF COMBINATORY CATEGORIAL GRAMMARS" doc

... 198 5a. Natural Language Parsing with Combinatory Categorial Grammars in a Graph- Unification-Based Formalism. Ph.D. disser- tation, University of Texas at Austin.[Some of this material is available ... 1987. A Lazy Way to Chart Parse with Categorial Grammars, this volume. Pollard, C. 1984. Generalized Phrase Structure Gram- mars, Head Grammars, and Natural Languages. Ph.D. dissertation, Stanford ... capacity of the gram- mars that Steedman assumes, say, for Dutch, is in the same class with Tree Adjoining Grammars (Joshi 1985) and Head Grammars (Pollard 1984). Thus, computational tractability...
  • 8
  • 354
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 functions as an oncogene ... TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward ... Leary RJ, Pagliarini R, Diaz LA,Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Lab-ourier E et al. (2006) The colorectal microRNAome.Proc Natl Acad Sci USA 103, 3687–3692.14 Yanaihara N, Caplen...
  • 11
  • 396
  • 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx

... of untreated Avicel.Multivariate statistical analysis of X-ray dataThe CrI of cellulose samples was also calculated by quanti-fying the contribution of amorphous cellulose (PASC) andAvicel ... shown are the average of quadrupli-cates.Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data andmultivariate statistical analysis) on the initial rate in Avicel enzymatichydrolysis ... carbon signals inNMR analysis could be obtained below a certaindegree of crystallinity and within a reasonable acquisi-tion time, so that X-ray diffraction was used as analternative to map...
  • 12
  • 554
  • 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... glycosylation mutants are sensitiveto aminoglycosides. Proc Natl Acad Sci USA 92, 1287–1291.13 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL &Fink GR (1999) The Arabidopsis thaliana proton ... in mammalian cells, deletion of ERS1does not dramatically affect cellular growth properties.Further, ers1D mutants do not display any apparentabnormal vacuolar morphology and treatment of ers1D ... McKenzie A, 3rd Demarini DJ, ShahNG, Wach A, Brachat A, Philippsen P & Pringle JR(1998) Additional modules for versatile and economicalPCR-based gene deletion and modification in Saccharo-myces...
  • 15
  • 378
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Metaphor Comprehension - A special mode of language pptx

... the larger and richer knowledge domains which have to be handled. The main conclusion of the paper is that the notions of processing capacity, memory constraints and control structure are ... the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.). The comprehension of metaphor does not require a special set of processes ... theories of metaphor within linguistics and psychology. 4. CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing language comprehension...
  • 2
  • 311
  • 0
Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx

Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx

... remainder of this article.Was heme lyase ever present inthe Excavata? A number of important human pathogens, such as try-panosomes, Giardia and Trichomonas, as well as a diverse assortment of ... greenalga C. reinhardtii and the malarial parasite Plasmo-dium falciparum (an apicomplexan) have heme lyasefor maturation of mitochondrial cytochromes c[2,15,32,75–77]. The mitochondrial genome ... lyaseevolve in a single eukaryote following the divergenceand radiation of the six eukaryotic supergroups(Excavata, Plantae, Chromalveolata, Rhizaria,Amoebozoa and Opisthokonts)? As sophisticated bio-informatics...
  • 18
  • 419
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM