Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx
... 67 Ga-transferrin from the intravascular to the extravascular spaces in the lungs, and it is therefore a measure of pulmonary capillary permeability to transferrin [19 ,20]. The mean PLI from the ... pulmonary infiltrates of unknown origin and in whom HSV -1 was isolated from tracheal aspirate or bronchoalveolar lavage fluid. At a median of 7 days (range 1 11...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
... FG and HK partici- pated in the data analysis and review of the manuscript. YN performed project planning, participated in the data analysis and helped to draft the manuscript. All authors read ... Darai G: Identification and mapping of the UL56 gene transcript of herpes simplex virus type 1. Virus Res 19 91, 19 :11 5 -12 6. 32. Koshizuka T, Goshima F,...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx
... R7020: A live attenuated recombinant herpes sim- plex virus (HSV) candidate vaccine. In Program and Abstacts of the 32nd Interscience Conference on Antimicrobial Agents and Chemother- apy American ... in drafting the manuscript, VNC participated in the construc- tion and characterization of the viruses, AB was involved in the design and conduction of in...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf
... TAGCAGTCATCCAACAGAATCAT Reverse AATCTTCTGAGTTGATTATGGGTAA TLR4 Forward ACACAGAAGAGCTGGCATGA Reverse GGTTGTCGGGGATTTTGTAG TLR9 Forward CTTCCCTGTAGCTGCTGTCC Reverse CCTGCACCAGGAGAGACAG IFN-α (1/ 13) ... statistical analyses, and drafted the manuscript. RKM participated in the PCR and protein assays. HK participated in the PCR assays. EB, HSK, MW and TV participated in the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: "Herpes simplex virus infection in pregnancy and in neonate: status of art of epidemiology, diagnosis, therapy and preventio" potx
... sexually transmitted-disease clinics. J Infect Dis 2002, 18 6 :13 81- 1389. 20. Arvaja M, Lehtinen M, Koskela P, Lappalainen M, Paavonen J, Vesikari T: Serological evaluation of herpes simplex virus type 1 and type 2 infections ... heals without sequelae whereas the CNS form is lethal in 6% of cases leaving 69% of permanent late sequelae. The disseminated infection...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot
... 5¢-GGTTGA CATATGAGCGAATC ⁄ Mm1028 His. rev 5¢-G AAGCTTCTTATAAAAGCCCC; and Mm 17 72 His.for 5 ¢-GGTGATAT CATATGGTAGAAGTCG ⁄ Mm 17 72 His.rev 5¢-GAAGA AAGCTTTAGAGGATAATCTCG) add- ing flanking NdeI and HindIII ... amplified using primers (Mm 218 4 His.for 5¢-CCAAATACA GGATCCATGGA- ATCTAC and Mm 218 4 His.rev 5¢-GA GAATTCATTT- AATAAAGAAGTCCTAAG) that added flanking BamHI and EcoRI sites a...
Ngày tải lên: 29/03/2014, 21:20
báo cáo khoa học: " Field transcriptome revealed critical developmental and physiological transitions involved in the expression of growth potential in japonica rice" potx
... participated in the design of the research, and carried out the microarray analysis and the statistical analysis and wrote the manuscript. BA performed the microarray analysis and analysis the ... embryo and extracted the total RNA. HT carried out sampling of leaves in 2009 and the microarray analysis. HM and KK performed data analysis and constructed...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: " Herpes simplex virus UL56 interacts with and regulates the Nedd4-family ubiquitin ligase Itch" pps
... (862 aa) contains a Ca 2+ /lipid binding C2 domain, four WW domains that interact with PY motifs, and a catalytic HECT domain. HSV UL56 (HSV -1, 234 aa; HSV-2, 235 aa) contains three PY motifs and ... 11 5:2 517 -2527. 29. Nishiyama Y, Yamada Y, Kurachi R, Daikoku T: Construction of a US3 lacZ insertion mutant of herpes simplex virus type 2 and characterization of i...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: Plasminogen activator inhibitor type-1 inhibits insulin signaling by competing with avb3 integrin for vitronectin binding pptx
... Lawrence (American Red Cross, Rockville, MD, USA): PAI -1 containing a mutation of Gln123 to Lys (PAI- 1K) has a specific defect in VN binding; PAI -1 containing a mutation of Arg340 to Ala (PAI- 1A) binds ... Blocking ligand occupancy of the alphaVbeta3 integrin inhibits insulin-like growth factor I signaling in vascular smooth muscle cells. Proc. Natl Acad. Sci. USA 95,...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo hóa học: " Human Immunodeficiency Virus type 1 in seronegative infants born to HIV-1-infected mothers" doc
... was performed using GAG1-GAG2 (5'TCCACCTATCCCAGTAGGAG3' and 5'GGTCGTTGCCAAAGAGTGAT3') or LTR1-LTR2 primers [7]. An aliquot (5 µL) of first round PCR product was then used as ... eight infants, and two of them tested positive for HIV DNA at 2 years of age. Nested PCR resulted in the amplification of gag, nef/LTR and Alu-LTR fragments, which demostrated tha...
Ngày tải lên: 20/06/2014, 01:20