Báo cáo khoa học: "Molecular characterisation of the early response in pigs to experimental infection with Actinobacillus pleuropneumoniae using cDNA microarrays" doc

... existing in faeces from the skunk silkworm, Bombyx mori. J Sericult Sci Japan 47, 161–165. 6 Inokuchi T & Yoshitake N (1978) Abnormality of amino acid metabolism in the mutant -skunk of the K. ... acts in the third step of leucine degradation and the sku mutant accumulates branched-chain amino acids in haemolymph, this mutant may be useful in the...

Ngày tải lên: 18/02/2014, 04:20

... various chemokines stimu- lated mainly by in ammatory cytokines, including IL-1b, TNF-a and IFN-c. (B) Chemokines expressed in the joint recruit leukocytes into the joints. In addition to functioning ... subclasses include the CC chemokines (where the cysteines are neighboring) and the CXC chemokines (where the cysteines are separated by one amino acid). The CXC c...

Ngày tải lên: 18/02/2014, 18:20

... destabilizing the double bond character of the pThr-Pro bond [26]. Further evidence is available for the catalytic mecha- nism of Pin1 resembling more closely that of the other prolyl cis ⁄ trans isomerases, ... molecular mechanisms of the enzyme action. Most importantly, we want to critically review the evidence that Pin1 would or would not act as a pro...

Ngày tải lên: 07/03/2014, 05:20

... Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity Nate rcia Conceic a o 1 , ... 5Â-CG GGATCCCAATCTGTTGCTAA TTAGG-3Â)andthe3Â specic oligonucleotides (5Â-GA AGATCTACCACACCTCCTCATCTCC-3Â) for ampli- cation of the regi...

Ngày tải lên: 08/03/2014, 10:20

... structures of the wild-type, single- and double-mutant EhPGKs in a closed conformation will certainly help to clarify the molecular arrangement in the guanine ring binding site during the binding of ... kinase gene for the corresponding amino acid residues present in the adenine nucleotide-dependent phospho- glycerate kinases and the recombinant proteins were pur...

Ngày tải lên: 16/03/2014, 01:20

... 2007 The Authors Journal compilation ª 2007 FEBS Molecular dynamics of the DNA- binding domain of the papillomavirus E2 transcriptional regulator uncover differential properties for DNA target accommodation M. ... the deformability required for the formation of the Early protein 2 C-terminal DNA- binding domain DNA complexes of var- i...

Ngày tải lên: 16/03/2014, 10:20

... Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis Roxane ... by the cell envelope of M. tuberculosis and to virulence [3–6]. Nevertheless, their precise molecular mechanisms of action are...

Ngày tải lên: 23/03/2014, 09:20

... 2007) doi:10.1111/j.1742-4658.2007.06139 .x cDNAs of the ecdysone receptor and the retinoid X receptor were cloned from the Japanese scorpion Liocheles australasiae, and the amino acid sequences were deduced. The full-length ... acids. The amino acid sequence of the L. australasiae ecdysone receptor was similar to that of the ecdysone recep...

Ngày tải lên: 30/03/2014, 04:20

... Taken together our results indicate that the C2 domain of plant phospholipase Da can act as a cardosin A- binding domain and suggest that plant C2 domains may have an additional role as RGD ⁄ KGE-recognition ... of both motifs and in particular their basic residues was fur- ther emphasized by the complete lack of interaction between the C2 domain...

Ngày tải lên: 30/03/2014, 11:20

... stage. The study about the nucleotide sequence of canine HIPK2 was performed for the development of cancer therapy because the attack rate of cancer has been increased depending on longevity of pets ... Activation of HIPK2 leads to the selective phosphorylation of p53, resulting in growth arrest and the enhancement of apoptosis. In this study, the canine HIPK2...

Ngày tải lên: 07/08/2014, 18:21

... been made toward the molecular dissection of the quantitative inheritance of wood property traits in loblolly pine (Pinus taeda L.) and several other forest tree species. QTL mapping experiments ... Diagram of the three-generation P. taeda pedigrees used in QTL mapping experiments. D.B. Neale et al .Wood property QTLs Original article Molecular dissection...

Ngày tải lên: 08/08/2014, 14:20

... of the Novirhabdovirus genus. The termini of the viral genome have conserved sequences at the 3'-end (CAUAG/UU) and 5'-end (G/AAUAUG) as other members of the Novirhabdovirus genus. The ... and coding regions of several other strains of VHSV have been deter- mined later [10]. In this study, we characterized the entire genome of the Great Lakes VHSV...

Ngày tải lên: 12/08/2014, 04:20

... in other IHNV strains. The first 15 of the 16 nucleotides at the 3’- and 5’-termini of the genome are complementary, and the first 4 nucleotides at 3’-ends of the IHNV are identical to other ... Vakharia 1* Abstract Background: Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae,...

Ngày tải lên: 12/08/2014, 04:21

... 7:49 http://www.virologyj.com/content/7/1/49 Page 3 of 12 RESEARC H Open Access Molecular characterisation of virulence graded field isolates of myxoma virus Kevin P Dalton * , Ines Nicieza, Aroa ... al.: Molecular characterisation of virulence graded field isolates of myxoma virus. Virology Journal 2010 7:49. Submit your next manuscript to BioMed Central an...

Ngày tải lên: 12/08/2014, 04:21

... Access Research Molecular characterisation of the early response in pigs to experimental infection with Actinobacillus pleuropneumoniae using cDNA microarrays Jakob Hedegaard 1 , Kerstin Skovgaard 2 , Shila Mortensen 2 , ... Determination of their specific roles during infection may lead to a better understanding of innate immunity in pigs. Competing...

Ngày tải lên: 12/08/2014, 18:21