Báo cáo sinh học: "Syntenator: Multiple gene order alignments with a gene-specific scoring function" docx

... four mammalian species, namely human (NCBI 36), mouse (NCBI m36), rat (RGSC 3.4) and dog (CanFam 1.0). We computed all pairwise all-against-all BLASTP searches in advance. The BLASTP hit ranks and ... regions as defined by alignment start and end coordinates. Genome coverage of nucleotide level alignments shrinks dramatically with increasing evo- lutionary distance. Gene order alignm...

Ngày tải lên: 12/08/2014, 17:20

... Ladyzhenskaya, V. A. Solonnikov, and N. N. Uraltseva, Linear and Quasilinear Equations of Parabolic Type, Nauka, Moscow, Russia, 1967. 20 C. V. Pao, Nonlinear Parabolic and Elliptic Equations, ... Nonlinear Analysis and Applications, Walter de Gruyter, Berlin, Germany, 1992. 16 S. Hu and N. S. Papageorgiou, Handbook of Multivalued Analysis. Vol. I, vol. 419 of Mathematics and Its Applica...

Ngày tải lên: 21/06/2014, 16:20

... paper, we present MCMC algorithms that allow Bayesian linkage analysis with a RAM. We study two alternative parameterizations of the genetic model and use a test statistic ... be sampled as well. In addition, absence of marker data hampers accurate estimation of genetic effects within granddaughters, which form the majority in a granddaught...

Ngày tải lên: 09/08/2014, 18:22

... variants have simpler implementations than the primal irrational variant [15, Algorithm 5.1] and the all-primal irrational variant [15, Algorithm 6.4] because computations with large rational numbers ... instances that cannot be solved with a dual algorithm in reasonable time. 1.4 The contribution of this paper The irrationalization technique of [6, 15] can be viewed as a method of tr...

Ngày tải lên: 07/08/2014, 15:23

... in ossification of vertebral bodies and progressive degenera- tion of intervertebral discs. Femoral defects were also noticed and animals usually died at around postnatal day AAbbssttrraacctt A previous ... Driller K, Pagenstecher A, Uhl M, Omran H, Berlis A, Grunder A, Sippel AE: NNuucclleeaarr ffaaccttoorr II XX ddeeffiicciieennccyy ccaauusseess bbrraaiinn mmaallffoorrmmaattiioonn aa...

Ngày tải lên: 06/08/2014, 18:21

... between Fl and P2) are also heterogeneous AA or AB animals (BC1) and AB or BB animals (BC2) with proportions 1/2, 1/2. The statistical analysis of the data obtained from ... a useful preliminary analysis of available data; and iv) retrospective studies of old experiments without marker information may be valuable. The basis for population gen...

Ngày tải lên: 09/08/2014, 18:21

... the variances of the individual genes. In general, the linear models are more flexible than the t-tests for analyzing microarray data in that they can analyze data where many factors are a ecting ... were compared in two publicly available data sets: the leukemia data of Golub et al. [6], and the apoAI knockout mice data of Callow et al. [4]. 2. METHODS 2.1. Leukemia data The advantage of the...

Ngày tải lên: 14/08/2014, 13:22

... posterior probability of having a QTL in the bracket. This probability of having a QTL within a bracket differs from the usual probability of having a QTL at a partic- ular position, e.g. within a particular ... likely as anywhere else in the bracket. Both assumptions are approximately valid when bracket sizes are small because with small bracket sizes all positions within a br...

Ngày tải lên: 14/08/2014, 13:22

... D10 Neg Pos days post-transfection D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A R N A D N A...

Ngày tải lên: 14/08/2014, 19:22

... using a TaqMan assay for gag gene sequences present in the vector (Forward primer 5' AGCTAGAACGATTCGCAGTTGAT 3', reverse primer 5' CCAGTATTTGTCTACAGCCTTCTGA 3', probe 5' ... Monash Medical Centre, VIC 3168, Australia and 6 Department of Obstetrics and Gynaecology, University of Adelaide, SA 5005, Australia Email: Donald S Anson* - donald.anson@adelaide.edu.au; Ch...

Ngày tải lên: 14/08/2014, 19:22