Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... receptor signaling architecture in normal and systemic lupus erythematosus T cells. SLE, systemic lupus erythematosus; TCR, T cell receptor. Normal T cell SLE T cell α α SLE T cell α Aggregated ... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3- mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematos...
Ngày tải lên: 12/08/2014, 15:22
... assisted in the interpretation of the results and in writing the final version of the manuscript. DMH assisted in the design in the study, in the interpretation of the results, and in writing the ... some of these autoantibodies may be saturated in vivo with circulating BLyS, rendering them incapable of binding to BLyS in the in vitro detection assay. We do not yet...
Ngày tải lên: 09/08/2014, 07:20
... noted that the interaction between epithelial cells and infiltrating T cells has been characterized in detail, but the cytokines involved in local B cell activation remain largely unknown. Chemokines The ... unknown. Chemokines The infiltration of lymphocytes into glandular aggregates apparently has a crucial role in the tissue pathology of SS. This process seems to be tightly r...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... found. Abundant interstitial infiltrates of T cells were observed in the bone marrow, but without intrasinusoidal localization. This case seems to support the hypothesis that T- LGL leukemia may develop ... presented in Table 1. The T- LGL leukemia treatment corrected cytopenias: neutropenia in 14 and anemia in 4 patients as well as symp- toms of arthritis. Therapy included me...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... mechanism that mediates the changes in steady-state mRNA levels triggered by TIA pro- teins? We propose that, in addition to mediating some of the signaling effects of the cytokines, chemokines and ... therefore, they could interact with basal transcription machinery and influence its activity. In addition, both pro- teins contain three RNA-binding motifs and are structurally clos...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... precursors of IgE-producing plasma cells that are increased in number in the airways of allergic indivi- duals [11]. The second crucial finding of this study is that the quantity of cat, Timothy and ... Asymptomatic subjects (without symptom s of asthma, rhinitis or eczema) were recruited by advertising. They were included into the study as “nonallergic subjects” only if they we...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA BV20 TGCCCCAGAATCTCTCAGCCTCCA BV21 ... properly cited. Abstract Introduction Type II collagen is a DR4/DR1 restricted target of self-reactive T cells that sustain rheumatoid arthritis. The aim of the present study...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... repertoire pattern. It would be interesting to detect the evolution of T- cell clonality in the patient at different disease status. The features of restric tive usage and absence of par- tial T cell ... 3). The clonality of TCR Va/Vb subfamily T- cells in different disease stages Polyclonality of T cells representing random rearrange- ment of TCR genes were detected...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo y học: "Importance of basophil activation testing in insect venom allergy" pdf
... submitting every patient with a history of Hymenoptera sting allergy and negative allergy tests to a provocation test [14]. Negative skin test and no specific IgE may indicate a non-allergic reaction ... a limited diag- nostic sensitivity of the test. An alternative mechanism that could activate mast cells in the absence of sIgE is com- plement activation and the generation of anaph...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: " Expression of transforming growth factor- in chronic idiopathic cough" pdf
... in chronic cough. While it is known that TGF exists in at least 3 isoforms, only the TGF1 isoform has been studied in the current study. Evaluation of other isoforms is important as demonstrated ... persistence. Competing interests The authors declare that they have no competing interests. Authors' contributions SX performed studies on laser-captured cells and the immunostainin...
Ngày tải lên: 12/08/2014, 14:20