Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... receptor signaling architecture in normal and systemic lupus erythematosus T cells. SLE, systemic
lupus erythematosus; TCR, T cell receptor.
Normal T cell
SLE T cell
α
α
SLE
T
cell
α
Aggregated ... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3-
mediated protein-tyrosyl phosphorylation in T cells from patients with
systemic lupus erythematos...
Báo cáo y học: "B lymphocyte stimulator (BLyS) isoforms in systemic lupus erythematosus: disease activity correlates better with blood leukocyte BLyS mRNA levels than with plasma BLyS protein levels" ppsx
... assisted in the interpretation of the
results and in writing the final version of the manuscript. DMH
assisted in the design in the study, in the interpretation of the
results, and in writing the ... some of
these autoantibodies may be saturated in vivo with circulating
BLyS, rendering them incapable of binding to BLyS in the in
vitro detection assay. We do not yet...
Báo cáo y học: "Abnormalities of B cell phenotype, immunoglobulin gene expression and the emergence of autoimmunity in Sjögren’s syndrome" pdf
... noted that the interaction
between epithelial cells and infiltrating T cells has been
characterized in detail, but the cytokines involved in local
B cell activation remain largely unknown.
Chemokines
The ... unknown.
Chemokines
The infiltration of lymphocytes into glandular aggregates
apparently has a crucial role in the tissue pathology of SS.
This process seems to be tightly r...
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... found.
Abundant interstitial infiltrates of T cells were observed in the
bone marrow, but without intrasinusoidal localization. This
case seems to support the hypothesis that T- LGL leukemia
may develop ... presented in
Table 1. The T- LGL leukemia treatment corrected cytopenias:
neutropenia in 14 and anemia in 4 patients as well as symp-
toms of arthritis. Therapy included me...
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... mechanism that mediates the
changes in steady-state mRNA levels triggered by TIA pro-
teins? We propose that, in addition to mediating some of the
signaling effects of the cytokines, chemokines and ... therefore, they could interact with basal transcription
machinery and influence its activity. In addition, both pro-
teins contain three RNA-binding motifs and are structurally
clos...
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... precursors of IgE-producing plasma cells that are
increased in number in the airways of allergic indivi-
duals [11].
The second crucial finding of this study is that the
quantity of cat, Timothy and ... Asymptomatic subjects (without
symptom s of asthma, rhinitis or eczema) were recruited
by advertising. They were included into the study as
“nonallergic subjects” only if they we...
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... GGGCTGGGCTTAAGGCAGATCTAC
BV15 CAGGCACAGGCTAAATTCTCCCTG
BV16 GCCTGCAGAACTGGAGGATTCTGG
BV17 TCCTCTCACTGTGACATCGGCCCA
BV18 CTGCTGAATTTCCCAAAGAGGGCC
BV19 TCCTCTCACTGTGACATCGGCCCA
BV20 TGCCCCAGAATCTCTCAGCCTCCA
BV21 ... properly cited.
Abstract
Introduction Type II collagen is a DR4/DR1 restricted target of
self-reactive T cells that sustain rheumatoid arthritis. The aim of
the present study...
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... repertoire pattern. It
would be interesting to detect the evolution of T- cell
clonality in the patient at different disease status.
The features of restric tive usage and absence of par-
tial T cell ... 3).
The clonality of TCR Va/Vb subfamily T- cells in different
disease stages
Polyclonality of T cells representing random rearrange-
ment of TCR genes were detected...
Báo cáo y học: "Importance of basophil activation testing in insect venom allergy" pdf
... submitting every patient with a history of
Hymenoptera sting allergy and negative allergy tests to a
provocation test [14]. Negative skin test and no specific
IgE may indicate a non-allergic reaction ... a limited diag-
nostic sensitivity of the test. An alternative mechanism
that could activate mast cells in the absence of sIgE is com-
plement activation and the generation of anaph...
Báo cáo y học: " Expression of transforming growth factor- in chronic idiopathic cough" pdf
... in
chronic cough. While it is known that TGF exists in at
least 3 isoforms, only the TGF1 isoform has been studied
in the current study. Evaluation of other isoforms is
important as demonstrated ... persistence.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
SX performed studies on laser-captured cells and the
immunostainin...