Báo cáo khoa học: "Stratification, Blinding and Placebo Effect in a Randomized, Double Blind Placebo-controlled Clinical Trial of Gold Bead Implantation in Dogs with Hip Dysplasia" doc

... the effect of blinding and placebo in a controlled clinical trial of pain treatment in CHD. Materials and methods Animals A total of 80 dogs recruited from all parts of Norway, with pain and ... Stratification, Blinding and Placebo Effect in a Ran- domized, Double Blind Placebo- controlled Clinical Trial of Gold Bead Implanta- tion...

Ngày tải lên: 12/08/2014, 15:21

... and new information in formulating a paraphrase that differs in a meaningful way from the user's question. A description is also given of the transformational grammar used by the paraphraser ... This example, as well as all sample questions and paraphrases that follow, were, =aken from actual sessions with the paraphraser. Question (A) mad its possible paraphca...

Ngày tải lên: 21/02/2014, 20:20

... amount of nutrients in the biomass or litter on a surface area basis. 2.4. Statistical analysis Statistical analysis was performed by a one-way analysis of variance (ANOVA), comparing the amounts of ... concentrations in leaves during a vegetative cycle showed that concentrations decreased in the case of N, P, and K; Mg showed an unvarying pattern, and Ca increased in...

Ngày tải lên: 08/08/2014, 14:22

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data not shown). By contrast, R. pachyptila amino acid ... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAbrR2...

Ngày tải lên: 18/02/2014, 16:20

... Materials and methods Strains and media Escherichia coli strain XL1-Blue MRF¢ (Stratagene, Heidel- berg, Germany) was used for plasmid handling. Saccharo- myces cerevisiae strain AST9-1B (Mata ... (5¢-GARATYTAYTTYGARCCT-3¢⁄5¢-WCCVARA ACAGCRTTTCC-3¢, SoPFK1; and 5¢-ACHATYGAY AAYGATATT-3¢⁄5¢-RTABGTDGGTRCTATGTA-3¢, So- PFK2) were incubated with 10 ng of cDNA substrate for 10 min at 98...

Ngày tải lên: 07/03/2014, 11:20

... of the 5¢ untranslated regions and the 3¢ untranslated regions containing polyadenylation signals (AATAAA) at three positions and the poly (A) -tails. The criteria for a consensus translation initiation ... arrow indicate the band of ST94 and that of ST94t, respectively. (A) Native-PAGE. Samples were run on 10–15% gradient gel with the same marker proteins as in Fig. 1B, an...

Ngày tải lên: 17/03/2014, 10:20

... kinase of Bacillus anthracis Abid R. Mattoo, Amit Arora, Souvik Maiti and Yogendra Singh Institute of Genomics and Integrative Biology, Delhi, India Serine, threonine and tyrosine protein kinases ... nucle- otide-binding motifs known as Walker A, A and B, with some exceptions [4]. The majority of the bacterial tyrosine kinases possess a transmembrane domain and an intrac...

Ngày tải lên: 23/03/2014, 06:20

... purified protein was missing methionine and alanine from the N-terminus. This was confirmed by the N-terminal sequences of HvTrxh2, determined to be AASATAAAVA and ASATAAAVAA. Multiple peaks were observed in the ... HvTrx2 decreases in abundance during micromalting, and HvTrxh1 also decrea- ses in abundance in the aleurone layer and endosperm, the lower form of HvTrxh1 remai...

Ngày tải lên: 23/03/2014, 17:22

... wide variety of plants, animals, fungi and bacteria, and play an important role in defense against microbial infection. Many of these small molecules are amphiphilic a- helices contain- ing clusters ... 4991, E-mail: susan.douglas@nrc.ca Abbreviations: AP-1, activator protein 1; ATF, activating transcription factor-1; CAAT, CCAAT binding factor; C/EBP, CAAT/enhancer binding protein...

Ngày tải lên: 31/03/2014, 07:20

... C-terminal arginine, was designed as follows (Fig. 3A) . Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively, ... 5¢-GAGGTCGAC...

Ngày tải lên: 31/03/2014, 09:20