... participated in study design, data analysis and interpretation, and drafting of the manuscript. WIJ partici- pated in data acquisition and drafting of the manuscript. SKE participated in study conception, ... Controlled; ANOVA = analysis of variance; APACHE = Acute Physiology and Chronic Health Evaluation, CI = con- fidence interval; DIS = daily interruption of sedation;...
Ngày tải lên: 25/10/2012, 10:35
... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCC...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: Artocarpus hirsuta lectin Differential modes of chemical and thermal denaturation potx
... molecular mass of 60 000 Da and high specificity f or methyl a- D -galactopyranoside (Me a- gal). The folding pathways of oligomeric proteins involve both intramolecular and intermolecular interactions. ... globule during unfolding of A. hirsuta lectin as observed in t he peanut lectin [6], was ruled out because a significant amount of th e tertiary and secondary structure...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx
... participated in data analysis, assembly and creation of the figures, and manuscript writing. EA contributed to the study design, experimentation, data analysis, assembly and creation of the figures, ... Quantitative analysis of cytokine gene expression in rheumatoid arthritis. J Immunol 1990, 144:3347-3353. 13. Morita Y, Yamamura M, Kawashima M, Harada S, Tsuji K, Shibuya K,...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Reactive oxygen species induce expression of vascular endothelial growth factor in chondrocytes and human articular cartilage explants" pps
... have a crucial role in the degeneration of articular cartilage by promoting neoangiogen- esis in the emerging synovial tissue and stimulating cartilage matrix-degrading pathways. Interestingly, ... to investigate the signal transduction pathways of PMA and SIN-1 in chondrocytes. Conclusion By amplifying distinct ROS-dependent destructive pathways in cartilage and joints, V...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Long noncoding RNA genes: conservation of sequence and brain expression among diverse amniotes" doc
... iden- tified in monotremata (platypus) and non-mammalian vertebrates. Finally, a polyaden ylation signal (ATAAA) located 30 bp upstream of the 3’ end of AK043754 in mouse is present in all examined amniote ... H, Ninomiya N, Akalin A, Sessa L, Lavorgna G, Brozzi A, Luzi L, Tan SL, Yang L, Kunarso G, Ng EL, Batalov S, Wahlestedt C, Kai C, Kawai J, Carninci P, Hayashizaki Y, W...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Cigarette smoke regulates the expression of TLR4 and IL-8 production by human macrophages" pdf
... IRAK and degradation of IκB-α by MDMs and phosphorylation of IRAK in HEK cellsFigure 6 CSM regulates phosphorylation of IRAK and degra- dation of IκB-α by MDMs and phosphorylation of IRAK in ... interests. Authors' contributions HS and EM equally conceived of the study, and partici- pated in the design of the study and performed immu- noassays, FACS ana...
Ngày tải lên: 11/08/2014, 08:22
Báo cáo y học: "Autoantibodies to low-density-lipoprotein-receptor-related protein 2 (LRP2) in systemic autoimmune diseases" pps
... sites): 5′-TTTgaattcCTGATGCACCTGTGCCACACC-3′ and 5′-TTTgtcgacAAAAATGAGATAGGGTTCGATGTTA-3′ for cDNA F2 (N9294–9713), 5′-TTTgaattcAACAGTAACATCGAACCCTATCTC-3′ and 5′-TTTgtcgacATTGTTGGTACCACAGGGATTGC-3′ for ... Institute of Medical Science, St Marianna University School of Medicine, Kawasaki, Kanagawa, Japan 2 Clinical Research Center for Allergy and Rheumatology, National Sagamihara H...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " Financial incentives to improve adherence to anti-psychotic maintenance medication in non-adherent patients - a cluster randomised controlled trial (FIAT)" ppsx
... estimate that between 1000 and a maximum of 5000 patients in the UK may fall into this category at one point of time. However, the implications of a positive finding may go beyond the UK and also affect ... for participation in the study. To include an AOT in the pool of eligible teams we will ask for prelimi- nary informed consent by the team manager. AOTs already pra...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: "Single ventricle with persistent truncus arteriosus as two rare entities in an adult patient: a case report" doc
... have some degree of hypoxemia caused by intracardiac shunting. Clinical manifestations are usually apparent shortly after birth. The most common findings are dyspnea, tachycardia, cyanosis, and ... heart failure. Later, secondary erythrocytosis and clubbing are usually present. The diagnosis may be defined by echocardiography, car- diac catheterization, and cardiac magnetic resonance...
Ngày tải lên: 11/08/2014, 23:21