Báo cáo y học: " A new pathway of glucocorticoid action for asthma treatment through the regulation of PTEN expression" pdf
... ssion. Data from all these assays together suggest that the effect of glucocorticoids on a sthma may partly pass through the PTEN signaling pathway, and that PTEN is a new target gene involved in the ... inhibits inflammation. As described above, PTEN maybe a target for asthma treatment. Regulation of PTEN expression is a key for this therapy. PTEN r...
Ngày tải lên: 12/08/2014, 13:22
... cervical distraction test and limited rotation toward the side of symptoms sec- ondary to pain – carried the greatest diagnostic accuracy as compared to the Gold Standard of electromyography. When ... separately, unless this was necessary to clar- ify information that was not readily apparent from the systematic review. Each study was reviewed by two authors (DRM and CFN) and deem...
Ngày tải lên: 13/08/2014, 14:20
... was greater than 30 l M .In this case the exact K d value was not assessed by Scatchard analysis because the highest SOCS-3 concentration was 30 l M and a calculation by the BIAEVALUATION software Fig. ... Matsumoto, A. , Masuhara, M., Mitsui, K., Yokouchi, M., Ohtsubo, M., Misawa, H., Miyajima, A. & Yoshimura, A. (1997) CIS, a cytokine inducible SH1 protein, is a target o...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... Hanasaki, K., Varki, A. , Stamenkovic, I. & Bevilacqua, M.P. (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... macrophages and lymphocytes increase in number at sites of inflammation and each are capable of modifying the overall inflammatory response [23]. Eosinophils, are of particular i...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... 319 CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC pDNter2 CARP from 71 to 319 CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC pDNter3 CARP from 102 to 319 CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC pDNter4 ... 319 GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG pYFP-CARP- CFP-HIS Full-length CARP 1–319 CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC pDNter1 CARP...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo y học: : A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis" pptx
... Available online http://arthritis-research.com/content/9/2/R27 Page 3 of 8 (page number not for citation purposes) S1 for ARAA and ERAA, S2 for KRAA, S3 for RRAA, and X for all non-RAA patterns. ... contributed specifically to the genotyping. GS and LN were specifically in charge of the autoantibody study. AC-T contributed to the sta- tistical analysis. BM, ACa and J-FB co...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps
... studied with any degree of accu- racy, it is important to quantitatively characterize light and dark as it affects the human circadian system because the light-dark pattern is the primary synchronizing ... seven-day measurement period, which indicate prolonged times of rest and, usually, darkness. Although many analyses of the activity and of the trans- formed CS data are po...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... were matured over two days, harvested and analyzed for cell yield and mature DC phenotype by flow cytometry, and then functionally analyzed for their ability to activate allogeneic T-cell or recall antigen ... Central Page 1 of 11 (page number not for citation purposes) Journal of Immune Based Therapies and Vaccines Open Access Original research A new approach for the large...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "A new association of multiple congenital anomalies/mental retardation syndrome with bradycardia-tachycardia syndrome: a case report" potx
... with bradycardia-tachycardia syndrome: a case report Chinnamuthu Murugesan*, Pradeep Kumar and Kanchi Muralidhar Address: Department of Anesthesia, Narayana Hrudayalaya Institute of Medical Sciences, ... syndrome, bradycardia-tachycardia syndrome and Dandy-Walker syndrome. His chromosomal study performed at the age of 5 was unremarkable (Figure 1). He was diagnosed as having bradyc...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: " A new modality of treatment for non-united fracture of the humerus in a patient with osteopetrosis: a case report" pptx
... consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Competing ... operatively. Open reduction and internal fixation was decided for the frac- ture of the humerus under general anaesthesia (GA) and axillary block. A delto-p...
Ngày tải lên: 11/08/2014, 19:21