báo cáo khoa học: " Global gene expression analysis of apple fruit development from the floral bud to ripe fruit" pot

... 14-3-3-binding status during apoptosis FEBS Journal 277 (2010) 33213342 ê 2010 The Author Journal compilation ê 2010 FEBS 3335 Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced ... apoptosis With the aim of further analyzing the role of 14-3-3 proteins in apoptosis, an evaluation of the ability of proteins to bind...

Ngày tải lên: 06/03/2014, 22:21

... RAST -PCR, rapid reverse transcription PCR analysis of unknown serial analysis of gene expression tags; rSAGE, reverse serial analysis of gene expression; SAGE, serial analysis of gene expression; ... compilation ê 2008 FEBS Semi-nested PCR analysis of unknown tags on serial analysis of gene expression Wang-Jie Xu 1 , Qiao-Li Li 1 ,...

Ngày tải lên: 07/03/2014, 04:20

... stimula- tion of VEGF gene expression by agents such as LPS and VEGF do not act through TNFa by an autocrine mechanism. Activation of VEGF gene expression in RAW-264.7 cells with LPS and VEGF was distinct ... reasons: (1) macrophages produce VEGF protein [9,10]; (2) neo-vascularization induced by VEGF contributes to disease in the in amed joint [11,12] and other in...

Ngày tải lên: 07/03/2014, 12:20

... 2004 Molecular and functional characterization of novel CRFR1 isoforms from the skin Alexander Pisarchik and Andrzej Slominski Department of Pathology and Laboratory Medicine, University of Tennessee ... epitope to the C terminus of the CRFR1 isoforms (Fig. 1C). The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47...

Ngày tải lên: 07/03/2014, 15:20

... 41144128 ê 2005 FEBS 4125 Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata Takehiko ... ecdysone receptor (EcR) and ultraspiracle (USP) of the coleopteran Colorado potato beetle Leptinotarsa decemlineata (LdEcR and LdU...

Ngày tải lên: 07/03/2014, 21:20

... 5Â-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 Â (forward, the mutagenesis codon underlined) and 5Â-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3Â (reverse). The pET151 HP1287 plasmid was ... from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity Nicola Barison 1,2 , Laura Cendron 1,2 , Alberto Trento...

Ngày tải lên: 16/03/2014, 00:20

... analyzed. The canals (ca) of the aquiferous system are lined by an epithelial layer formed from pinacocytes. Magnifications: A- a and B -a, · 25; A- b and B-b, · 50; A- c and B-c, · 100. Ó FEBS 2004 Activation ... recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor...

Ngày tải lên: 16/03/2014, 16:20

... compilation ê 2008 FEBS 3501 Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes Mami Yamazaki 1,2 , ... drug. Differential gene expression analysis of the two forms by cDNA- differential display led to the identification of several...

Ngày tải lên: 23/03/2014, 07:20

... 4. Glycolysis and gluconeogenesis As shown in Fig. 3A, several genes encoding enzymes participating in glycolysis are preferentially expressed in perivenous cells. These include the genes encoding sorbi- tol ... gradients in oxygen tension, hor- mones ⁄ growth factors, and b-catenin signaling that have been suspected to in uence zonal gene expression in the liver [1,5,22,...

Ngày tải lên: 23/03/2014, 10:20

... for gene therapy in cancer. Results Cloning of the 5Â-upstream region of the Pokemon gene To identify the regulatory sequences that control expression of the Pokemon gene, a 2204-bp section of the ... To further determine the cooperation between the NEG-U and NEG-D elements, 2 lg of the NEG-U decoy, 2 lg of the NEG-D decoy, and a combination of...

Ngày tải lên: 30/03/2014, 04:20

... gene regu- lation, by modulating the level of expression and ⁄ or determining the specific pattern of expression of a gene [34–39]. To evaluate the relevance of the leader intron in cardosin expression, ... library screening of four full-length genes encoding cardosins A, B, C and D precursors, together with the cloning of a partial sequence of the cypros...

Ngày tải lên: 30/03/2014, 09:20

... patients with acute toxicity and without it. Those genes were gathered in 4 significant pathways. We could not identify a set of genes that segregates patients with and without late toxicity. In conclusion, ... NA, Haveman J, Klein B, Turesson I, Vrieling H, Giphart-Gassler M: Analysis of gene expression using gene sets discriminates cancer patients with and witho...

Ngày tải lên: 09/08/2014, 09:22

... article Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments Bo Yang 1 , Yuanqing Jiang 2 , ... analyses of BnWRKY genes in response to fungal challengeFigure 3 Expression analyses of BnWRKY genes in response to fungal...

Ngày tải lên: 12/08/2014, 03:20

... 1 of 12 (page number not for citation purposes) BMC Plant Biology Open Access Research article Comparative gene expression profiles between heterotic and non -heterotic hybrids of tetraploid Medicago ... that expression pattern in heterotic hybrids. But expression of each individual gene is itself the result of a number of gene interactions, and he...

Ngày tải lên: 12/08/2014, 03:21

... tomato sequence had homology to an apple gene and in the case of the tubulin genes to three apple genes. For the tubulin genes the pat- terns of expression mostly differed between apple and tomato ... with the developmentally regulated tomato genes but not examined further since the tomato microar- ray did not include a floral bud sample. The expression d...

Ngày tải lên: 12/08/2014, 05:20