báo cáo khoa học: " A first step in understanding an invasive weed through its genes: an EST analysis of invasive Centaurea maculosa" doc
... first step in understanding an invasive weed through its genes: an EST analysis of invasive Centaurea maculosa Amanda K Broz 1,2 , Corey D Broeckling 1,3 , Ji He 4 , Xinbin Dai 4 , Patrick X Zhao 4 ... predominant in its native Eurasian habitat [10]. Ecological and green- house investigations suggest that invasive C. maculosa is a strong competitor ag...
Ngày tải lên: 12/08/2014, 05:20
... not available several years ago. As a matter of fact, these new techniques exceed the capacity of well- established manual or scantily automated analysis by far. Automated high-throughput analysis ... acquisition Image analysis Analysis of preview images • Detection of interesting regions Analysis of detailed images • Segmentation of transformed cells • Segmentation of...
Ngày tải lên: 12/08/2014, 05:20
... synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction Paola Turina and B. Andrea Melandri Department of Biology, Laboratory of ... chromato- phores and known amounts of isolated Rb. capsulatus ATP synthase, the unknown amount of ATP synthase was evaluated by detecting the b subunit with an anti-(b subunit...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx
... Local trees are arrangements of categories, which in turn are arrangements of feature specifica- tions; the latter are themselves items consisting of a feature name and a feature value in an ... homogeneous and estab- lish a parallelism that can be expressed in the traditional notation ~ of an analogy: (3) FCR : category :: CCR : local tree Linguistic items (cate...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC AT...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf
... features: • All the bigrams and trigrams of words and POS tags in the candidate sentence. • Bigrams and trigrams of words and POS tags in the original sentence in combination with their binary labels in ... training to rerank the candi- dates generated in the first step. Reranking has been used in many tasks to find better global solutions, such as machine translation (Wang et...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCAT TCAACCGCTTCTCATG GATTTC). BglII- and SalI-digested mutant inserts were ligated into the BamHI–SalI ... oligonucleotide and an antisense oligonucleotide containing an SstI site 5¢-AT GCACACACGTAAGGCACTCAGCTGAGAT CTCGAG- 3¢. The BamHI–KpnI and BamHI–SstI restriction fragment...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: "A First-Language-Oriented Writing Assistant System" potx
... methods leveraging bilingual parallel corpora is proposed by Bannard and Callison-Burch (2005). They identify paraphrases using a phrase in another language as a pivot. Using bilingual parallel ... prediction, paraphrase suggestion and translation tasks. As described in (Carpuat and Wu, 2007), the disambiguation model plays an important role in the machine translation task...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... detection of the unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used. Quantification of the ... NY, USA). RNA extraction and RT-PCR analysis Cells were harvested 48 h post-transfection and total RNA was prepared using the TRIzol reagent (Invitrogen, Carls- bad, CA, USA) accordin...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... franciscana [18]. The lack of a Ca 2+ -inducible PTP in embryos of A. franciscana marks a cornerstone in our understand- ing of the long-term tolerance, extending for years, to anoxia and diapause, ... cyclo- sporin A and BKA. ANT of A. franciscana shows low similarity to ANTs from other species The results obtained above prompted us to clone and sequence ANT of A. fran...
Ngày tải lên: 29/03/2014, 00:20