Báo cáo khoa học: " Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein" docx

... from the generation of an electro- chemical gradient across the IM forms the basis of the IM w m . During cell death, MP often increases, allow- ing for the release of soluble proteins. The only mechanism ... compilation ê 2010 FEBS Hepatic stimulator substance mitigates hepatic cell injury through suppression of the mitochondrial permeability t...

Ngày tải lên: 16/02/2014, 09:20

... col- lagen synthesis of lung fibroblasts. Our novel findings on the role of the b-catenin signaling pathway in a-de- fensin-induced increases in proliferation and collagen synthesis of lung fibroblasts ... among lung fibroblasts. Inhibition of the b-catenin signaling pathway using quercetin blocked the a-defensin-induced increase in lung fibroblast prol...

Ngày tải lên: 18/02/2014, 06:20

... subfamily and, in this case, even to a subset of eight members. The finding that, within the A-6 subfamily, not all of its members interact with BPM1 indicates that BPM proteins assemble only with ... proteins assemble with members of the ERF ⁄ AP2 transcription factor family Because it has been shown previously that Arabidopsis BPM proteins use their BTB...

Ngày tải lên: 18/02/2014, 06:20

... 24162427 ê 2005 FEBS Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate Re ´ gis Nouaille 1,2 , Maria Matulova 1,3 , Anne-Marie Delort 1 and Evelyne Forano 2 1 ... released into the medium. The present work provides further details regarding the metabolism of MDs in F. succinogenes. These Table 1. Production of suc...

Ngày tải lên: 07/03/2014, 17:20

... that the catalytic sites of the enzyme are functional and are distinguishable on the basis of bind- ing with the inhibitor. Careful analysis of Fig. 2 shows that inactivation of E 3 by trypsin and ... Council of Scientic and Industrial Research, New Delhi. Journal compilation ê 2009 FEBS 6727 UDP-galactose 4-epimerase from Kluyveromyces fragilis...

Ngày tải lên: 16/03/2014, 00:20

... our interest in the potential interplay between the 2-oxo acid dehydrogenase complexes and thioredoxin via the complex-bound lipoate. Unraveling an in vivo function of a thioredoxin species is complicated ... sensitive link between the 2-oxo acid dehydrogenase reaction and surrounding medium. Self -regulation of the complexes by the redox state...

Ngày tải lên: 17/03/2014, 09:20

... iterative assembly of the quinoline- and quinox- aline-type class of chromodepsipeptides, capable of macrolactonization and macrothiolactonization. The substrate specificity of TioS T-TE was determined ... cycliza- tion-efficiency, and to establish TioS T-TE as a general catalyst for the ligation and cyclization of the quino- line- and quinoxaline-t...

Ngày tải lên: 23/03/2014, 06:20

... flavinylated either in the WT- HA strain or in the flx1D-HA strain. These experi- ments also showed that the availability and attachment of flavin cofactors are not involved in the regulation of Sdh1p ... refer- ences therein, using the impermeable inhibitor phenyl- succinate (Fig. 1C). Over the concentration range 0. 1–0 .5 mm, the overall process of succinate re...

Ngày tải lên: 23/03/2014, 07:20

... NM_007601 .3 mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC CARP Ankyrin repeat domain 1 NM_0 134 68 mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R ... 31 9 CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC pDNter2 CARP from 71 to 31 9 CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC pDNter3 CARP from 102 to...

Ngày tải lên: 29/03/2014, 21:20

... K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M & Shinagawa H (2001) Complete genome sequence of enterohemorrhagic Escherichia ... change in EspA, a component of the Escherichia coli O157:H7 type III secretion system Tomoaki Kato 1,2 , Daizo Hamada 2 , Takashi Fukui 2 , Makoto Hayas...

Ngày tải lên: 30/03/2014, 16:20

... N-termini and within an adjacent 29 -amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an important role in DNA ... box-containing genes in various other organisms. Furthermore, the BmMEF2 gene is expressed in various tissues containing muscle and neural tissues in Bombyx as well as...

Ngày tải lên: 30/03/2014, 20:20

... terminologies from dif- ferent domains, varying the size of the training material. Second, analyzing the segmentation in- duced by analogical learning would be interesting. Third, we need to address ... Computational Linguistics Improvements in Analogical Learning: Application to Translating multi-Terms of the Medical Domain Philippe Langlais DIRO Univ. of...

Ngày tải lên: 31/03/2014, 20:20

... class="bi x0 y0 w3 h1a" alt="" Original article Effects of gelling agents on growth, mineral composition and naphthoquinone content of in vitro explants of hybrid walnut tree (Juglans ... explants growing on agar (fig 4). Naphthoquinone content Regarding the content of hydrojuglone glu- coside and juglone in leaves, stem and...

Ngày tải lên: 08/08/2014, 23:22

... RESEARCH ARTICLE Open Access Introgression potential between safflower (Carthamus tinctorius) and wild relatives of the genus Carthamus Marion Mayerhofer 1 , Reinhold Mayerhofer 1 , Deborah Topinka 2 , ... number of its wild relatives, creating the possibility of gene flow from safflower to weedy species. In this study we looked at the introgression p...

Ngày tải lên: 11/08/2014, 11:21

... of 11 (page number not for citation purposes) Virology Journal Open Access Research Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA- dependent RNA ... Comparisons of the M1 genome segments and encoded μ2 proteins of different reovirus isolates. Virol J 1(6):. 35. Chiu CJ, Lee LH: Cloning and nucleoti...

Ngày tải lên: 12/08/2014, 04:21