Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

... affect the susceptibility of HCVcc to heat treatment. Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of ... 10152025303540 * 0 1 2 3 4 5 0246 Minutes Log 10 FFU/ml 8 65 C 60 C B 56 C Log 10 FFU/ml HCVcc in culture medium HCVcc in culture medium HCVcc in human serum 0 1 2 3 4 5 6 0102030...
Ngày tải lên : 12/08/2014, 04:21
  • 12
  • 411
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... Martin (Institut Pasteur, Paris, France). The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment was cleaved by the restriction ... SU, Purcell RH & Bukh J (1998) Transcripts of a chimeric cDNA clone of hepatitis C virus genotype 1b are infec- tious in vivo. Virology 244, 161–172. 22 Mottola G, Cardinali...
Ngày tải lên : 20/02/2014, 01:20
  • 15
  • 597
  • 0
Báo cáo khoa học: Thermodynamic stability and folding of proteins from hyperthermophilic organisms doc

Báo cáo khoa học: Thermodynamic stability and folding of proteins from hyperthermophilic organisms doc

... a heptameric state of cpn10 when it cycles on and off of the cpn60 complex in vivo. Cpn10 unfolds ⁄ dissociates in a biphasic reaction in GuHCl that involves protein unfolding prior to hept- amer dissociation ... structural model of AmFd suggests that a combination of additional sur- face ion pairs, the zinc cofactor, and an efficiently packed core govern the high stability...
Ngày tải lên : 07/03/2014, 05:20
  • 11
  • 507
  • 0
Báo cáo khoa học: Thermal unfolding and aggregation of actin Stabilization and destabilization of actin filaments doc

Báo cáo khoa học: Thermal unfolding and aggregation of actin Stabilization and destabilization of actin filaments doc

... saturating concentrations, cofilin strongly increases the thermal stability of F-actin increasing the temperature at which thermal transition occurs by 7 C and increasing the cooperativity of the ... to investigate the thermal unfolding of F-actin in complexes with cofilin, a small actin-binding protein belonging to the actin-depolymerizing factor (ADF) ⁄ cofilin family of p...
Ngày tải lên : 30/03/2014, 04:20
  • 16
  • 488
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... ATGCTCATCAGTAGATTCTGCTCAC Real-time PCR ZFil10-F ACGCTTCTTCTTTGCGACTG Real-time PCR ZFil10-R CACCATATCCCGCTTGAGTT Real-time PCR Zfgata3-F GCTTCTTCCTCCTCGCTGTC Real-time PCR Zfgata3-R TGCACTCTTTGTCTTCCTGTCG ... GGAACACACAGAGGGGATGATA Initial PCR Zffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCR Zffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCR Zffoxp3-R2 CTGCTTTTCTGGGGACTTCA Initial PCR Zf3¢foxp3-F1 TGAA...
Ngày tải lên : 16/02/2014, 09:20
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... four GAT-speci c primers; CLGAT5a (5¢-GGCATCAACAT- CACAAGCAACAAGTGCAAG-3¢), CLGAT5b (5¢-TCCT- CCATCAATCTGCTTCCATGGACCATC-3¢), CLGAT3a (5¢-GCTGTGGCTACGAATGAGGCCGCC-3) and CLGAT3b (5¢-AAGGGAGAGAAACCTGACCTTGCACTTG-3¢). ... the CLGAT cDNA by PCR with the primers CLGAT3b and CLGAT 3c (5¢-GGTACTCGTATCCCCATCCACCG-3¢). The amplified fragment was purified using the MinElute Gel Extraction Kit (Qia...
Ngày tải lên : 20/02/2014, 03:20
  • 12
  • 649
  • 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... R.P., Ackrell, B.A .C. , Sices, H. & Cecchini, G. (1993) Escherichia coli fumarate reductase frdC and frdD mutants. Identification of amino acid residues involved in catalytic activity with quinones. ... boiled. Protein content was determined with the Bicinchoninic Acid Protein Assay Kit (Pierce), using horse heart cytochrome c as standard (Sigma). The relative molecular mass of...
Ngày tải lên : 21/02/2014, 00:20
  • 12
  • 593
  • 0
báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot

báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot

... importance of offering practical support, often in the form of transporting clients to appointments and acted as an advocate within Turning Point in establishing a no-cost treatment scheme when clients ... most common mode of transmission of HCV in Australia – accounting for approximately 80% of all HCV cases [2], and over 90% of newly acquired HCV infections [3]. The pr...
Ngày tải lên : 11/08/2014, 18:20
  • 9
  • 303
  • 0
Báo cáo y học: " Prevalence, correlates and pattern of hepatitis B surface antigen in a low resource setting" doc

Báo cáo y học: " Prevalence, correlates and pattern of hepatitis B surface antigen in a low resource setting" doc

... million of these infected population die due to the consequences of the infection such as liver ci rrhosis and hepatocellular carci- noma [4]. Despite the existence of a safe and effective vaccine, ... College of Obstetricians and Gynaecologists (RCOG) of the Uni- ted Kingdom [14], the American College of Obstetrics and Gynecology (ACOG) [15], and most of the other 122...
Ngày tải lên : 11/08/2014, 21:21
  • 8
  • 441
  • 0
Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

... Response of human immunodefi- ciency virus- infected patients receiving highly active antiret- roviral therapy to vaccination with 23-valent pneumococcal polysaccharide vaccine. Clin Infect Dis ... rate of response in this cohort of HIV- infected patients vaccinated with HBV recombinant vac- cine (60.7%) of the population fully immunized, increas- ing vaccine did not have a benefic...
Ngày tải lên : 10/08/2014, 05:20
  • 5
  • 361
  • 0

Xem thêm

Từ khóa: